EMAIL THIS PAGE TO A FRIEND

HTR2A

5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled

267 Gene Product Result for
Synonyms: 5-HT2A HTR2
UniProtKB ID: P28223, B2RAC5, B4DZ79, F5GWE8, Q5T8C0
Gene ID:
Human(3356) Summary: This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(15558) 5-hydroxytryptamine (serotonin) receptor 2A
Rat(29595) 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
chicken(428070) 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
cow(407230) 5-hydroxytryptamine (serotonin) receptor 2A
domestic cat(101081108) 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Horse(100009685) 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
dog(403882) 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
domestic guinea pig(100135545) 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
naked mole-rat(101708395) 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0884 (±)-Propranolol hydrochloride ≥99% (TLC), powder human pricing
S003 1-(1-Naphthyl)piperazine hydrochloride needles human pricing
H-076 9-Hydroxyrisperidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
A2729 Amisulpride ≥98% (HPLC) human pricing
BP1090 Amisulpride British Pharmacopoeia (BP) Reference Standard human pricing
A0590000 Amisulpride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001534 Amisulpride for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP1143 Amisulpride for system suitability British Pharmacopoeia (BP) Reference Standard human pricing
A-119 Aripiprazole solution 1.0 mg/mL (50:50 Methanol/Water with 1% 1N HCl), ampule of 1 mL, certified reference material, Cerilliant® human pricing
A-080 Aripiprazole solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
A-101 Asenapine maleate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
C8138 Chlorpromazine hydrochloride ≥98% (TLC) human pricing
C0982 Chlorpromazine hydrochloride meets USP testing specifications human pricing
31679 Chlorpromazine hydrochloride VETRANAL®, analytical standard human pricing
1125006 Chlorpromazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1900000 Chlorpromazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP856 Chlorpromazine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
285374 Chlorpromazine hydrochloride 98% human pricing
C-904 Chlorpromazine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
C1671 Chlorprothixene hydrochloride human pricing
C1915000 Chlorprothixene hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP905 Clozapine British Pharmacopoeia (BP) Reference Standard human pricing
C2460000 Clozapine European Pharmacopoeia (EP) Reference Standard human pricing
1142107 Clozapine United States Pharmacopeia (USP) Reference Standard human pricing
C171 Clozapine solid human pricing
C7198 Clozapine drug standard, 1.0 mg/mL in methanol human pricing
Y0000758 Clozapine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
1142108 Clozapine Resolution Mixture United States Pharmacopeia (USP) Reference Standard human pricing
C-059 Clozapine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4542 Cyclobenzaprine hydrochloride human pricing
C3200000 Cyclobenzaprine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP886 Cyclobenzaprine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
C-060 Cyclobenzaprine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
C6022 Cyproheptadine hydrochloride sesquihydrate ≥98% (TLC), solid human pricing
D1414 Droperidol human pricing
D3100000 Droperidol European Pharmacopoeia (EP) Reference Standard human pricing
BP675 Droperidol British Pharmacopoeia (BP) Reference Standard human pricing
1229001 Droperidol United States Pharmacopeia (USP) Reference Standard human pricing
PHR1724 Haloperidol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1303002 Haloperidol United States Pharmacopeia (USP) Reference Standard human pricing
BP407 Haloperidol British Pharmacopoeia (BP) Reference Standard human pricing
H0100000 Haloperidol European Pharmacopoeia (EP) Reference Standard human pricing
H100 Haloperidol human pricing
Y0001518 Haloperidol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001517 Haloperidol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
H-030 Haloperidol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
SML1528 Iloperidone ≥98% (HPLC) human pricing
1336249 Iloperidone United States Pharmacopeia (USP) Reference Standard human pricing
I-011 Iloperidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S006 Ketanserin (+)-tartrate salt ≥97%, solid human pricing
1370702 Loxapine succinate United States Pharmacopeia (USP) Reference Standard human pricing
L106 Loxapine succinate salt solid human pricing
SML2069 Lurasidone hydrochloride ≥98% (HPLC) human pricing
L-030 Lurasidone hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
L2411 LY-367,265 human pricing
M3324 M100907 ≥98% (HPLC) human pricing
M4068 Mesoridazine benzenesulfonate ≥98% (HPLC), powder human pricing
BP496 Mesoridazine besilate British Pharmacopoeia (BP) Reference Standard human pricing
1393005 Mesoridazine besylate United States Pharmacopeia (USP) Reference Standard human pricing
M137 Methysergide maleate salt solid human pricing
Y0000705 Mirtazapine European Pharmacopoeia (EP) Reference Standard human pricing
BP842 Mirtazapine British Pharmacopoeia (BP) Reference Standard human pricing
1444279 Mirtazapine United States Pharmacopeia (USP) Reference Standard human pricing
Y0000721 Mirtazapine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
M-128 Mirtazapine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1445459 Molindone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M1818 Molindone hydrochloride ≥98% (HPLC), solid human pricing
N5536 Nefazodone hydrochloride ≥98% (HPLC), solid human pricing
1457902 Nefazodone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
O111 Octoclothepin maleate salt solid human pricing
PHR1825 Olanzapine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
O1141 Olanzapine ≥98% (HPLC) human pricing
1478301 Olanzapine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001370 Olanzapine European Pharmacopoeia (EP) Reference Standard human pricing
BP1060 Olanzapine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001380 Olanzapine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
O-024 Olanzapine solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P0099 Paliperidone ≥98% (HPLC) human pricing
1491809 Paliperidone United States Pharmacopeia (USP) Reference Standard human pricing
1539508 Pimozide United States Pharmacopeia (USP) Reference Standard human pricing
BP682 Pimozide British Pharmacopoeia (BP) Reference Standard human pricing
P1750000 Pimozide European Pharmacopoeia (EP) Reference Standard human pricing
P126 Pirenperone >97%, solid human pricing
P6656 Promazine hydrochloride human pricing
46674 Promazine hydrochloride VETRANAL®, analytical standard human pricing
1569000 Promazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P3390000 Promazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001419 Quetiapine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1592704 Quetiapine fumarate United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 883.09 ((C21H25N3O2S)2 · C4H4O4) human pricing
Y0001657 Quetiapine fumarate European Pharmacopoeia (EP) Reference Standard human pricing
PHR1856 Quetiapine Fumarate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Q-001 Quetiapine fumarate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
Q3638 Quetiapine hemifumarate salt ≥98% (HPLC) human pricing
R3030 Risperidone ≥98% (HPLC), powder human pricing
PHR1631 Risperidone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1604654 Risperidone United States Pharmacopeia (USP) Reference Standard human pricing
BP1137 Risperidone British Pharmacopoeia (BP) Reference Standard human pricing
R1000600 Risperidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000370 Risperidone for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP1158 Risperidone impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
R-006 Risperidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S7201 SR-46349 hemifumarate salt ≥98% (HPLC) human pricing
T9025 Thioridazine hydrochloride ≥99% human pricing
1663008 Thioridazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T1300000 Thioridazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T-905 Thioridazine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1665003 Thiothixene United States Pharmacopeia (USP) Reference Standard human pricing
T4937 Thiothixene meets USP testing specifications human pricing
T6154 Trazodone hydrochloride ≥99% (HPLC), powder human pricing
1673500 Trazodone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP590 Trazodone hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
BP591 Trazodone hydrochloride impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
T-030 Trazodone hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8516 Trifluoperazine dihydrochloride ≥99%, powder human pricing
T-117 Trifluoperazine dihydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
T6062 Trifluoperazine hydrochloride meets USP testing specifications human pricing
1685000 Trifluoperazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T2000000 Trifluoperazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T-904 Trimipramine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001272 Ziprasidone for system suitability 1 European Pharmacopoeia (EP) Reference Standard human pricing
Y0001241 Ziprasidone for system suitability 2 European Pharmacopoeia (EP) Reference Standard human pricing
1724408 Ziprasidone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0001286 Ziprasidone hydrochloride monohydrate European Pharmacopoeia (EP) Reference Standard human pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
M0443 Mirtazapine ≥98% (HPLC) human, mouse, rat pricing
128945 Phenethylamine 99% human, mouse, rat pricing
241008 Phenethylamine ≥99% human, mouse, rat pricing
407267 Phenethylamine purified by redistillation, ≥99.5% human, mouse, rat pricing
P1793 Pimozide human, mouse, rat pricing
S7771 (S)-(−)-Sulpiride ≥98% (titration) human, rat pricing
38827 4,4′-Dimethoxytriphenylmethyl chloride ≥97.0% (HPLC) human, rat pricing
C117 5-Carboxamidotryptamine maleate salt powder, ≥98% (HPLC) human, rat pricing
286583 5-Methoxytryptamine 97% human, rat pricing
M1626 6-Methoxyharmalan crystalline human, rat pricing
C6305 Clozapine human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline ≥95% human, rat pricing
L7007 Lysergic acid diethylamide human, rat pricing
M2017 Mazindol ≥98% (TLC), powder human, rat pricing
M3668 Metergoline human, rat pricing
65372 O-Methylserotonin purum, ≥98.0% (NT) human, rat pricing
P2279 Psilocin human, rat pricing
R103 Ritanserin powder human, rat pricing
S0693 SB 204741 >98% (HPLC) human, rat pricing
S7395 Spiperone solid human, rat pricing
M22601 1-(2-Methoxyphenyl)piperazine 98% mouse, rat pricing
300764 1,2,3,4-Tetrahydro-9H-pyrido[3,4-b]indole 98% rat pricing
571083 1-Benzoylpiperazine 97% rat pricing
13815 1-Benzylpiperazine ≥97.0% (GC) rat pricing
79224 1-Phenyl-1,3,8-triazaspiro[4.5]decan-4-one ≥96.0% (HPLC) rat pricing
D206709 2,2-Diphenylethylamine 96% rat pricing
357677 2,5-Dimethoxyphenethylamine 97% rat pricing
476021 2-Methoxyphenethylamine 98% rat pricing
142360 4-Benzylpiperidine 99% rat pricing
291552 6-Methoxy-1,2,3,4-tetrahydro-9H-pyrido[3,4-b]indole 97% rat pricing
610240 DL-Amphetamine solution 1 mg/mL in methanol, drug standard rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
M2381 5-Methoxy-N,N-dimethyltryptamine human, rat pricing
P4054 Psilocin solution 100 μg/mL in methanol, drug standard human, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023531 MISSION® esiRNA targeting mouse Htr2a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000621 Rosetta Predictions human pricing
NM_017254 Rosetta Predictions rat pricing
NM_172812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241851 predicted 238
2 SASI_Hs01_00241852 predicted 481
3 SASI_Hs01_00241853 predicted 721
4 SASI_Hs01_00241854 predicted 357
5 SASI_Hs01_00241855 predicted 453
6 SASI_Hs01_00241856 predicted 583
7 SASI_Hs01_00241857 predicted 1368
8 SASI_Hs01_00241858 predicted 1253
9 SASI_Hs01_00241859 predicted 682
10 SASI_Hs01_00241860 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104685 predicted 816
2 SASI_Rn01_00104686 predicted 294
3 SASI_Rn01_00104687 predicted 1235
4 SASI_Rn01_00104689 predicted 380
5 SASI_Rn02_00261643 predicted 287
6 SASI_Rn01_00104690 predicted 502
7 SASI_Rn01_00104691 predicted 657
8 SASI_Rn02_00261644 predicted 1188
9 SASI_Rn01_00104693 predicted 1295
10 SASI_Rn01_00104694 predicted 909
11 SASI_Rn01_00104688 predicted 1192
12 SASI_Rn01_00104692 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125499 predicted 1104
2 SASI_Mm01_00125500 predicted 1843
3 SASI_Mm01_00125501 predicted 2456
4 SASI_Mm01_00125502 predicted 2585
5 SASI_Mm01_00125503 predicted 1542
6 SASI_Mm01_00125504 predicted 1411
7 SASI_Mm02_00344736 predicted 1694
8 SASI_Mm01_00125505 predicted 2262
9 SASI_Mm01_00125506 predicted 1739
10 SASI_Mm01_00125508 predicted 1137
11 SASI_Mm01_00125507 predicted 1411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000621
HTR2A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-781s21c1
Sequence:CCGGAGGACGATTCGAAGGTCTTTACTCGAGTAAAGACCTTCGAATCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-734s21c1
Sequence:CCGGGACCATATCAGTAGGTATATCCTCGAGGATATACCTACTGATATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000621.1-2054s1c1
Sequence:CCGGGCCACTAAGGTCAGTGTTATACTCGAGTATAACACTGACCTTAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-345s1c1
Sequence:CCGGCCTTACTTCATCTCCAGGAAACTCGAGTTTCCTGGAGATGAAGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-1224s1c1
Sequence:CCGGCCCTGCTCAATGTGTTTGTTTCTCGAGAAACAAACACATTGAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-180s1c1
Sequence:CCGGGCTCAACTACGAACTCCCTAACTCGAGTTAGGGAGTTCGTAGTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-812s21c1
Sequence:CCGGTTGCTTACTCGCCGATGATAACTCGAGTTATCATCGGCGAGTAAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-1397s1c1
Sequence:CCGGGCCTACAAGTCTAGCCAACTTCTCGAGAAGTTGGCTAGACTTGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000621
HTR2A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-781s21c1
Sequence:CCGGAGGACGATTCGAAGGTCTTTACTCGAGTAAAGACCTTCGAATCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-734s21c1
Sequence:CCGGGACCATATCAGTAGGTATATCCTCGAGGATATACCTACTGATATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000621.1-2054s1c1
Sequence:CCGGGCCACTAAGGTCAGTGTTATACTCGAGTATAACACTGACCTTAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-345s1c1
Sequence:CCGGCCTTACTTCATCTCCAGGAAACTCGAGTTTCCTGGAGATGAAGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-1224s1c1
Sequence:CCGGCCCTGCTCAATGTGTTTGTTTCTCGAGAAACAAACACATTGAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-180s1c1
Sequence:CCGGGCTCAACTACGAACTCCCTAACTCGAGTTAGGGAGTTCGTAGTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-812s21c1
Sequence:CCGGTTGCTTACTCGCCGATGATAACTCGAGTTATCATCGGCGAGTAAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-1397s1c1
Sequence:CCGGGCCTACAAGTCTAGCCAACTTCTCGAGAAGTTGGCTAGACTTGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000621
HTR2A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-781s21c1
Sequence:CCGGAGGACGATTCGAAGGTCTTTACTCGAGTAAAGACCTTCGAATCGTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-734s21c1
Sequence:CCGGGACCATATCAGTAGGTATATCCTCGAGGATATACCTACTGATATGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000621.1-2054s1c1
Sequence:CCGGGCCACTAAGGTCAGTGTTATACTCGAGTATAACACTGACCTTAGTGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-345s1c1
Sequence:CCGGCCTTACTTCATCTCCAGGAAACTCGAGTTTCCTGGAGATGAAGTAAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-1224s1c1
Sequence:CCGGCCCTGCTCAATGTGTTTGTTTCTCGAGAAACAAACACATTGAGCAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-180s1c1
Sequence:CCGGGCTCAACTACGAACTCCCTAACTCGAGTTAGGGAGTTCGTAGTTGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000621.2-812s21c1
Sequence:CCGGTTGCTTACTCGCCGATGATAACTCGAGTTATCATCGGCGAGTAAGCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000621.1-1397s1c1
Sequence:CCGGGCCTACAAGTCTAGCCAACTTCTCGAGAAGTTGGCTAGACTTGTAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172812
HTR2A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-2221s1c1
Sequence:CCGGCCCACTGGTATATACGTTGTTCTCGAGAACAACGTATATACCAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172812.1-2534s1c1
Sequence:CCGGCCAGGGTGTGTGAACAAGTTTCTCGAGAAACTTGTTCACACACCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1293s1c1
Sequence:CCGGCCATTCTTCATCTCCAGGAAACTCGAGTTTCCTGGAGATGAAGAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1783s1c1
Sequence:CCGGCGATGACAACTTTGTCCTCATCTCGAGATGAGGACAAAGTTGTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1702s1c1
Sequence:CCGGCGTAGGTATATCCATGCCAATCTCGAGATTGGCATGGATATACCTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172812
HTR2A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-2221s1c1
Sequence:CCGGCCCACTGGTATATACGTTGTTCTCGAGAACAACGTATATACCAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172812.1-2534s1c1
Sequence:CCGGCCAGGGTGTGTGAACAAGTTTCTCGAGAAACTTGTTCACACACCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1293s1c1
Sequence:CCGGCCATTCTTCATCTCCAGGAAACTCGAGTTTCCTGGAGATGAAGAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1783s1c1
Sequence:CCGGCGATGACAACTTTGTCCTCATCTCGAGATGAGGACAAAGTTGTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1702s1c1
Sequence:CCGGCGTAGGTATATCCATGCCAATCTCGAGATTGGCATGGATATACCTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172812
HTR2A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-2221s1c1
Sequence:CCGGCCCACTGGTATATACGTTGTTCTCGAGAACAACGTATATACCAGTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172812.1-2534s1c1
Sequence:CCGGCCAGGGTGTGTGAACAAGTTTCTCGAGAAACTTGTTCACACACCCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1293s1c1
Sequence:CCGGCCATTCTTCATCTCCAGGAAACTCGAGTTTCCTGGAGATGAAGAATGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1783s1c1
Sequence:CCGGCGATGACAACTTTGTCCTCATCTCGAGATGAGGACAAAGTTGTCATCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172812.1-1702s1c1
Sequence:CCGGCGTAGGTATATCCATGCCAATCTCGAGATTGGCATGGATATACCTACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???