EMAIL THIS PAGE TO A FRIEND

HTR2B

5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled

99 Gene Product Result for
Synonyms: 5-HT(2B) 5-HT2B
UniProtKB ID: P41595, B2R9D5, Q53TI1, Q62221, Q6P523
Gene ID:
Human(3357) Summary: This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. [provided by RefSeq, Oct 2011]
Mouse(15559) 5-hydroxytryptamine (serotonin) receptor 2B
Rat(29581) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Zebrafish(751784) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
cow(407135) 5-hydroxytryptamine (serotonin) receptor 2B
Horse(100057052) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
domestic cat(101095762) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
dog(403881) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
chicken(395581) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
domestic guinea pig(100135546) 5-hydroxytryptamine (serotonin) receptor 2B
naked mole-rat(101699201) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
sheep(101106827) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Domestic Rabbit(100343392) 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
M2381 5-Methoxy-N,N-dimethyltryptamine human, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000867 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052881 MISSION® esiRNA esiRNA human HTR2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000867 Rosetta Predictions human pricing
NM_017250 Rosetta Predictions rat pricing
NM_008311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117988 predicted 995
2 SASI_Hs01_00117989 predicted 1926
3 SASI_Hs01_00117990 predicted 877
4 SASI_Hs01_00117991 predicted 1852
5 SASI_Hs01_00117992 predicted 571
6 SASI_Hs01_00117993 predicted 824
7 SASI_Hs01_00117994 predicted 944
8 SASI_Hs01_00117995 predicted 1871
9 SASI_Hs01_00117996 predicted 1576
10 SASI_Hs02_00303396 predicted 1837
11 SASI_Hs01_00117997 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082790 predicted 283
2 SASI_Rn01_00082791 predicted 604
3 SASI_Rn01_00082792 predicted 1743
4 SASI_Rn01_00082793 predicted 927
5 SASI_Rn01_00082794 predicted 1548
6 SASI_Rn01_00082795 predicted 660
7 SASI_Rn01_00082797 predicted 1569
8 SASI_Rn01_00082798 predicted 746
9 SASI_Rn01_00082799 predicted 1393
10 SASI_Rn02_00261638 predicted 437
11 SASI_Rn01_00082796 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036847 predicted 844
2 SASI_Mm01_00036848 predicted 707
3 SASI_Mm01_00036849 predicted 926
4 SASI_Mm01_00036850 predicted 1404
5 SASI_Mm02_00313622 predicted 1656
6 SASI_Mm01_00036851 predicted 492
7 SASI_Mm01_00036852 predicted 1446
8 SASI_Mm01_00036853 predicted 889
9 SASI_Mm01_00036854 predicted 1375
10 SASI_Mm01_00036855 predicted 1033
11 SASI_Mm01_00036856 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008311
HTR2B MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-1229s1c1
Sequence:CCGGCCGAGCCACAAAGTCAGTAAACTCGAGTTTACTGACTTTGTGGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-420s1c1
Sequence:CCGGGCCTGGTTATTCCTCGATGTTCTCGAGAACATCGAGGAATAACCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-591s1c1
Sequence:CCGGGCCATCCCAGTCCCTATTAAACTCGAGTTTAATAGGGACTGGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-219s1c1
Sequence:CCGGGCGGTGATAATACCCACCATTCTCGAGAATGGTGGGTATTATCACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-67s1c1
Sequence:CCGGGCACAACTTCTGAGCACATTTCTCGAGAAATGTGCTCAGAAGTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-907s21c1
Sequence:CCGGATCGAGACTGATGTGATTAATCTCGAGATTAATCACATCAGTCTCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-665s21c1
Sequence:CCGGCAATCATGTTTGAGGCTATATCTCGAGATATAGCCTCAAACATGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-1219s21c1
Sequence:CCGGGAGACACTTATGCGAAGAATGCTCGAGCATTCTTCGCATAAGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008311
HTR2B MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-1229s1c1
Sequence:CCGGCCGAGCCACAAAGTCAGTAAACTCGAGTTTACTGACTTTGTGGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-420s1c1
Sequence:CCGGGCCTGGTTATTCCTCGATGTTCTCGAGAACATCGAGGAATAACCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-591s1c1
Sequence:CCGGGCCATCCCAGTCCCTATTAAACTCGAGTTTAATAGGGACTGGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-219s1c1
Sequence:CCGGGCGGTGATAATACCCACCATTCTCGAGAATGGTGGGTATTATCACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-67s1c1
Sequence:CCGGGCACAACTTCTGAGCACATTTCTCGAGAAATGTGCTCAGAAGTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-907s21c1
Sequence:CCGGATCGAGACTGATGTGATTAATCTCGAGATTAATCACATCAGTCTCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-665s21c1
Sequence:CCGGCAATCATGTTTGAGGCTATATCTCGAGATATAGCCTCAAACATGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-1219s21c1
Sequence:CCGGGAGACACTTATGCGAAGAATGCTCGAGCATTCTTCGCATAAGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008311
HTR2B MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-1229s1c1
Sequence:CCGGCCGAGCCACAAAGTCAGTAAACTCGAGTTTACTGACTTTGTGGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-420s1c1
Sequence:CCGGGCCTGGTTATTCCTCGATGTTCTCGAGAACATCGAGGAATAACCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-591s1c1
Sequence:CCGGGCCATCCCAGTCCCTATTAAACTCGAGTTTAATAGGGACTGGGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-219s1c1
Sequence:CCGGGCGGTGATAATACCCACCATTCTCGAGAATGGTGGGTATTATCACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008311.1-67s1c1
Sequence:CCGGGCACAACTTCTGAGCACATTTCTCGAGAAATGTGCTCAGAAGTTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-907s21c1
Sequence:CCGGATCGAGACTGATGTGATTAATCTCGAGATTAATCACATCAGTCTCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-665s21c1
Sequence:CCGGCAATCATGTTTGAGGCTATATCTCGAGATATAGCCTCAAACATGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008311.2-1219s21c1
Sequence:CCGGGAGACACTTATGCGAAGAATGCTCGAGCATTCTTCGCATAAGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000867
HTR2B MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-544s1c1
Sequence:CCGGGCACAATTCCTGAGCACATTTCTCGAGAAATGTGCTCAGGAATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-1685s1c1
Sequence:CCGGCCGATATATCACCTGCAATTACTCGAGTAATTGCAGGTGATATATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-1074s1c1
Sequence:CCGGCCAGTCCCTATTAAAGGGATACTCGAGTATCCCTTTAATAGGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-897s1c1
Sequence:CCGGGCCTGGTTATTTCTTGACGTTCTCGAGAACGTCAAGAAATAACCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000867.2-1964s1c1
Sequence:CCGGGCAGTTGTCATCAAACATAATCTCGAGATTATGTTTGATGACAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000867.4-1063s21c1
Sequence:CCGGTGCCATTCCAGTCCCTATTAACTCGAGTTAATAGGGACTGGAATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000867.4-885s21c1
Sequence:CCGGTATGTCCTGCCTGGTTATTTCCTCGAGGAAATAACCAGGCAGGACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000867
HTR2B MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-544s1c1
Sequence:CCGGGCACAATTCCTGAGCACATTTCTCGAGAAATGTGCTCAGGAATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-1685s1c1
Sequence:CCGGCCGATATATCACCTGCAATTACTCGAGTAATTGCAGGTGATATATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-1074s1c1
Sequence:CCGGCCAGTCCCTATTAAAGGGATACTCGAGTATCCCTTTAATAGGGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-897s1c1
Sequence:CCGGGCCTGGTTATTTCTTGACGTTCTCGAGAACGTCAAGAAATAACCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000867.2-1964s1c1
Sequence:CCGGGCAGTTGTCATCAAACATAATCTCGAGATTATGTTTGATGACAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000867.4-1063s21c1
Sequence:CCGGTGCCATTCCAGTCCCTATTAACTCGAGTTAATAGGGACTGGAATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000867.4-885s21c1
Sequence:CCGGTATGTCCTGCCTGGTTATTTCCTCGAGGAAATAACCAGGCAGGACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000867
HTR2B MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-544s1c1
Sequence:CCGGGCACAATTCCTGAGCACATTTCTCGAGAAATGTGCTCAGGAATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-1685s1c1
Sequence:CCGGCCGATATATCACCTGCAATTACTCGAGTAATTGCAGGTGATATATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-1074s1c1
Sequence:CCGGCCAGTCCCTATTAAAGGGATACTCGAGTATCCCTTTAATAGGGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000867.2-897s1c1
Sequence:CCGGGCCTGGTTATTTCTTGACGTTCTCGAGAACGTCAAGAAATAACCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000867.2-1964s1c1
Sequence:CCGGGCAGTTGTCATCAAACATAATCTCGAGATTATGTTTGATGACAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000867.4-1063s21c1
Sequence:CCGGTGCCATTCCAGTCCCTATTAACTCGAGTTAATAGGGACTGGAATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000867.4-885s21c1
Sequence:CCGGTATGTCCTGCCTGGTTATTTCCTCGAGGAAATAACCAGGCAGGACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)