EMAIL THIS PAGE TO A FRIEND

HTR3A

5-hydroxytryptamine (serotonin) receptor 3A, ionotropic

130 Gene Product Result for
Synonyms: 5-HT-3 5-HT3A 5-HT3R 5HT3R HTR3
Gene ID:
Human(3359) Summary: The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(15561) 5-hydroxytryptamine (serotonin) receptor 3A
Rat(79246) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
chicken(428247) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
cow(617674) 5-hydroxytryptamine (serotonin) receptor 3A
Horse(100009690) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
domestic cat(101098004) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
dog(489399) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
domestic guinea pig(100135547) 5-hydroxytryptamine (serotonin) receptor 3A
naked mole-rat(101714088) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
sheep(101110536) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Domestic Rabbit(100009570) 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501479 Anti-5-HT-3A antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB2108457 Anti-HTR3A affinity isolated antibody canine, mouse, rat, bovine, horse, human
immunohistochemistry, western blot pricing
SAB2108393 Anti-HTR3A antibody produced in rabbit affinity isolated antibody guinea pig, human, rabbit, rat, horse
western blot pricing
AV13046 Anti-HTR3A antibody produced in rabbit affinity isolated antibody rat, canine, mouse, human, bovine, horse
immunohistochemistry, western blot pricing
SAB2106373 Anti-HTR3A antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, rat, rabbit, human
ELISA, western blot pricing
SAB2500926 Anti-Serotonin Receptor 3A/HTR3A antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000869 Rosetta Predictions human pricing
NM_213621 Rosetta Predictions human pricing
NM_024394 Rosetta Predictions rat pricing
NM_001099644 Rosetta Predictions mouse pricing
NM_013561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047510 predicted 535
2 SASI_Hs01_00047511 predicted 308
3 SASI_Hs01_00047513 predicted 549
4 SASI_Hs01_00047514 predicted 1477
5 SASI_Hs01_00047515 predicted 415
6 SASI_Hs01_00047516 predicted 799
7 SASI_Hs01_00047517 predicted 1314
8 SASI_Hs01_00047518 predicted 1559
9 SASI_Hs01_00047519 predicted 1621
10 SASI_Hs02_00303399 predicted 473
11 SASI_Hs01_00047512 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231151 predicted 533
2 SASI_Hs01_00231152 predicted 315
3 SASI_Hs01_00231154 predicted 547
4 SASI_Hs01_00231155 predicted 1577
5 SASI_Hs01_00231156 predicted 418
6 SASI_Hs01_00231157 predicted 794
7 SASI_Hs01_00231158 predicted 1411
8 SASI_Hs01_00231159 predicted 1656
9 SASI_Hs01_00231160 predicted 1715
10 SASI_Hs02_00374306 predicted 469
11 SASI_Hs01_00231153 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036643 predicted 967
2 SASI_Rn01_00036644 predicted 351
3 SASI_Rn01_00036645 predicted 1322
4 SASI_Rn01_00036646 predicted 762
5 SASI_Rn01_00036648 predicted 710
6 SASI_Rn01_00036649 predicted 1540
7 SASI_Rn01_00036650 predicted 1539
8 SASI_Rn01_00036651 predicted 840
9 SASI_Rn01_00036652 predicted 1122
10 SASI_Rn02_00263990 predicted 796
11 SASI_Rn01_00036647 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301945 predicted 830
2 SASI_Mm02_00301946 predicted 579
3 SASI_Mm02_00301947 predicted 325
4 SASI_Mm02_00301948 predicted 316
5 SASI_Mm02_00301949 predicted 805
6 SASI_Mm02_00301950 predicted 534
7 SASI_Mm02_00301951 predicted 730
8 SASI_Mm02_00301952 predicted 1662
9 SASI_Mm02_00301953 predicted 739
10 SASI_Mm02_00301954 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322296 predicted 832
2 SASI_Mm01_00100788 predicted 581
3 SASI_Mm02_00322297 predicted 331
4 SASI_Mm01_00100789 predicted 312
5 SASI_Mm01_00100794 predicted 799
6 SASI_Mm01_00100796 predicted 543
7 SASI_Mm01_00100797 predicted 724
8 SASI_Mm02_00322298 predicted 1683
9 SASI_Mm02_00322299 predicted 737
10 SASI_Mm02_00322300 predicted 1624
11 SASI_Mm01_00100790 predicted 305
12 SASI_Mm01_00100791 predicted 1589
13 SASI_Mm01_00100792 predicted 1505
14 SASI_Mm01_00100793 predicted 916
15 SASI_Mm01_00100795 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000869
HTR3A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000869.1-1911s1c1
Sequence:CCGGGCTCTCTTAGATCAGGAGAAACTCGAGTTTCTCCTGATCTAAGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-1608s1c1
Sequence:CCGGCTACAGCATCACCCTGGTTATCTCGAGATAACCAGGGTGATGCTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-1032s1c1
Sequence:CCGGCGAGAGGGTCTCTTTCAAGATCTCGAGATCTTGAAAGAGACCCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-893s1c1
Sequence:CCGGGCAGTAACTACTATGCAGAAACTCGAGTTTCTGCATAGTAGTTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-513s1c1
Sequence:CCGGCCCTGAGGACTTTGACAACATCTCGAGATGTTGTCAAAGTCCTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000869.5-430s21c1
Sequence:CCGGCCGTATCCATTGACGTCATTGCTCGAGCAATGACGTCAATGGATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000869.5-2006s21c1
Sequence:CCGGCATTGACCCTCACCTGAATAACTCGAGTTATTCAGGTGAGGGTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000869.5-646s21c1
Sequence:CCGGCAAATATCCCGTACGTGTATACTCGAGTATACACGTACGGGATATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000869
HTR3A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000869.1-1911s1c1
Sequence:CCGGGCTCTCTTAGATCAGGAGAAACTCGAGTTTCTCCTGATCTAAGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-1608s1c1
Sequence:CCGGCTACAGCATCACCCTGGTTATCTCGAGATAACCAGGGTGATGCTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-1032s1c1
Sequence:CCGGCGAGAGGGTCTCTTTCAAGATCTCGAGATCTTGAAAGAGACCCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-893s1c1
Sequence:CCGGGCAGTAACTACTATGCAGAAACTCGAGTTTCTGCATAGTAGTTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-513s1c1
Sequence:CCGGCCCTGAGGACTTTGACAACATCTCGAGATGTTGTCAAAGTCCTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000869.5-430s21c1
Sequence:CCGGCCGTATCCATTGACGTCATTGCTCGAGCAATGACGTCAATGGATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000869.5-2006s21c1
Sequence:CCGGCATTGACCCTCACCTGAATAACTCGAGTTATTCAGGTGAGGGTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000869.5-646s21c1
Sequence:CCGGCAAATATCCCGTACGTGTATACTCGAGTATACACGTACGGGATATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000869
HTR3A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000869.1-1911s1c1
Sequence:CCGGGCTCTCTTAGATCAGGAGAAACTCGAGTTTCTCCTGATCTAAGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-1608s1c1
Sequence:CCGGCTACAGCATCACCCTGGTTATCTCGAGATAACCAGGGTGATGCTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-1032s1c1
Sequence:CCGGCGAGAGGGTCTCTTTCAAGATCTCGAGATCTTGAAAGAGACCCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-893s1c1
Sequence:CCGGGCAGTAACTACTATGCAGAAACTCGAGTTTCTGCATAGTAGTTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000869.1-513s1c1
Sequence:CCGGCCCTGAGGACTTTGACAACATCTCGAGATGTTGTCAAAGTCCTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000869.5-430s21c1
Sequence:CCGGCCGTATCCATTGACGTCATTGCTCGAGCAATGACGTCAATGGATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000869.5-2006s21c1
Sequence:CCGGCATTGACCCTCACCTGAATAACTCGAGTTATTCAGGTGAGGGTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000869.5-646s21c1
Sequence:CCGGCAAATATCCCGTACGTGTATACTCGAGTATACACGTACGGGATATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013561
HTR3A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013561.1-1793s1c1
Sequence:CCGGGCGTCAAGTCTGGTTTCCTTACTCGAGTAAGGAAACCAGACTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-1110s1c1
Sequence:CCGGCCTAGACAGAATAGCCTGGATCTCGAGATCCAGGCTATTCTGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-566s1c1
Sequence:CCGGCCTTTGATGTGCAGAACTGTTCTCGAGAACAGTTCTGCACATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-1004s1c1
Sequence:CCGGGCATGGCTCTGCTAGTGATAACTCGAGTTATCACTAGCAGAGCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-725s1c1
Sequence:CCGGTCAAGGAGTTCAGCATAGATACTCGAGTATCTATGCTGAACTCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013561
HTR3A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013561.1-1793s1c1
Sequence:CCGGGCGTCAAGTCTGGTTTCCTTACTCGAGTAAGGAAACCAGACTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-1110s1c1
Sequence:CCGGCCTAGACAGAATAGCCTGGATCTCGAGATCCAGGCTATTCTGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-566s1c1
Sequence:CCGGCCTTTGATGTGCAGAACTGTTCTCGAGAACAGTTCTGCACATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-1004s1c1
Sequence:CCGGGCATGGCTCTGCTAGTGATAACTCGAGTTATCACTAGCAGAGCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-725s1c1
Sequence:CCGGTCAAGGAGTTCAGCATAGATACTCGAGTATCTATGCTGAACTCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013561
HTR3A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 3A, ionotropic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013561.1-1793s1c1
Sequence:CCGGGCGTCAAGTCTGGTTTCCTTACTCGAGTAAGGAAACCAGACTTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-1110s1c1
Sequence:CCGGCCTAGACAGAATAGCCTGGATCTCGAGATCCAGGCTATTCTGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-566s1c1
Sequence:CCGGCCTTTGATGTGCAGAACTGTTCTCGAGAACAGTTCTGCACATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-1004s1c1
Sequence:CCGGGCATGGCTCTGCTAGTGATAACTCGAGTTATCACTAGCAGAGCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013561.1-725s1c1
Sequence:CCGGTCAAGGAGTTCAGCATAGATACTCGAGTATCTATGCTGAACTCCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)