EMAIL THIS PAGE TO A FRIEND

HTR3B

5-hydroxytryptamine (serotonin) receptor 3B, ionotropic

82 Gene Product Result for
Synonyms: 5-HT3B
UniProtKB ID: O95264, B0YJ23, Q0VJC3
Gene ID:
Human(9177) Summary: The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit B of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It is not functional as a homomeric complex, but a pentaheteromeric complex with subunit A (HTR3A) displays the full functional features of this receptor. [provided by RefSeq, Aug 2011]
Mouse(57014) 5-hydroxytryptamine (serotonin) receptor 3B
Rat(58963) 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
sheep(101110267) 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
domestic guinea pig(100736034) 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
naked mole-rat(101726074) 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
cow(541055) 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
domestic cat(101082340) 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
dog(611236) 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006028 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014241 MISSION® esiRNA esiRNA targeting mouse Htr3b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006028 Rosetta Predictions human pricing
NM_022189 Rosetta Predictions rat pricing
NM_020274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017834 predicted 239
2 SASI_Hs01_00017835 predicted 688
3 SASI_Hs01_00017836 predicted 588
4 SASI_Hs01_00017837 predicted 460
5 SASI_Hs01_00017838 predicted 740
6 SASI_Hs01_00017839 predicted 958
7 SASI_Hs01_00017840 predicted 1145
8 SASI_Hs01_00017841 predicted 735
9 SASI_Hs01_00017842 predicted 308
10 SASI_Hs01_00017843 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090967 predicted 839
2 SASI_Rn01_00090968 predicted 887
3 SASI_Rn01_00090969 predicted 812
4 SASI_Rn01_00090970 predicted 726
5 SASI_Rn01_00090971 predicted 1047
6 SASI_Rn01_00090973 predicted 1057
7 SASI_Rn01_00090974 predicted 859
8 SASI_Rn01_00090975 predicted 713
9 SASI_Rn02_00262935 predicted 525
10 SASI_Rn01_00090976 predicted 749
11 SASI_Rn01_00090972 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030419 predicted 1460
2 SASI_Mm01_00030420 predicted 1007
3 SASI_Mm01_00030421 predicted 702
4 SASI_Mm01_00030422 predicted 1219
5 SASI_Mm01_00030423 predicted 757
6 SASI_Mm01_00030424 predicted 534
7 SASI_Mm01_00030425 predicted 1141
8 SASI_Mm01_00030426 predicted 272
9 SASI_Mm01_00030427 predicted 920
10 SASI_Mm01_00030428 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020274
HTR3B MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020274.4-1528s21c1
Sequence:CCGGACCGCTGGTCTCACTTGATATCTCGAGATATCAAGTGAGACCAGCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020274.4-1232s21c1
Sequence:CCGGGATGCCGAGGAGTCTAGATTGCTCGAGCAATCTAGACTCCTCGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020274.2-1975s1c1
Sequence:CCGGCCCTGCTCAAACCTGCTTAAACTCGAGTTTAAGCAGGTTTGAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-592s1c1
Sequence:CCGGCCTATGTATACGTGAACTCTTCTCGAGAAGAGTTCACGTATACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-704s1c1
Sequence:CCGGCCTCACCTTTAATAGCATTCTCTCGAGAGAATGCTATTAAAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-1413s1c1
Sequence:CCGGGCCATCCTGTATCGCTTTGATCTCGAGATCAAAGCGATACAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-929s1c1
Sequence:CCGGCCTCTTGATACCTAGCATCTTCTCGAGAAGATGCTAGGTATCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020274
HTR3B MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020274.4-1528s21c1
Sequence:CCGGACCGCTGGTCTCACTTGATATCTCGAGATATCAAGTGAGACCAGCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020274.4-1232s21c1
Sequence:CCGGGATGCCGAGGAGTCTAGATTGCTCGAGCAATCTAGACTCCTCGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020274.2-1975s1c1
Sequence:CCGGCCCTGCTCAAACCTGCTTAAACTCGAGTTTAAGCAGGTTTGAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-592s1c1
Sequence:CCGGCCTATGTATACGTGAACTCTTCTCGAGAAGAGTTCACGTATACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-704s1c1
Sequence:CCGGCCTCACCTTTAATAGCATTCTCTCGAGAGAATGCTATTAAAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-1413s1c1
Sequence:CCGGGCCATCCTGTATCGCTTTGATCTCGAGATCAAAGCGATACAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-929s1c1
Sequence:CCGGCCTCTTGATACCTAGCATCTTCTCGAGAAGATGCTAGGTATCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020274
HTR3B MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020274.4-1528s21c1
Sequence:CCGGACCGCTGGTCTCACTTGATATCTCGAGATATCAAGTGAGACCAGCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020274.4-1232s21c1
Sequence:CCGGGATGCCGAGGAGTCTAGATTGCTCGAGCAATCTAGACTCCTCGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020274.2-1975s1c1
Sequence:CCGGCCCTGCTCAAACCTGCTTAAACTCGAGTTTAAGCAGGTTTGAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-592s1c1
Sequence:CCGGCCTATGTATACGTGAACTCTTCTCGAGAAGAGTTCACGTATACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-704s1c1
Sequence:CCGGCCTCACCTTTAATAGCATTCTCTCGAGAGAATGCTATTAAAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-1413s1c1
Sequence:CCGGGCCATCCTGTATCGCTTTGATCTCGAGATCAAAGCGATACAGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020274.2-929s1c1
Sequence:CCGGCCTCTTGATACCTAGCATCTTCTCGAGAAGATGCTAGGTATCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006028
HTR3B MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006028.3-1580s21c1
Sequence:CCGGGACCACATCTCTACCAGTAAACTCGAGTTTACTGGTAGAGATGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006028.3-1023s21c1
Sequence:CCGGAGTCCATCGTGTTGGTCAAATCTCGAGATTTGACCAACACGATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006028.3-253s21c1
Sequence:CCGGCCTGTTCGTCCATGCTATATTCTCGAGAATATAGCATGGACGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006028.2-1655s1c1
Sequence:CCGGCCACATCTCTACCAGTAAATACTCGAGTATTTACTGGTAGAGATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-601s1c1
Sequence:CCGGGCGTGCAGTTTAGAGACATATCTCGAGATATGTCTCTAAACTGCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-431s1c1
Sequence:CCGGCCAGCATGTTTGATGAGATTACTCGAGTAATCTCATCAAACATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-1293s1c1
Sequence:CCGGGCTTCAATCTATCAGCAACTACTCGAGTAGTTGCTGATAGATTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006028
HTR3B MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006028.3-1580s21c1
Sequence:CCGGGACCACATCTCTACCAGTAAACTCGAGTTTACTGGTAGAGATGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006028.3-1023s21c1
Sequence:CCGGAGTCCATCGTGTTGGTCAAATCTCGAGATTTGACCAACACGATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006028.3-253s21c1
Sequence:CCGGCCTGTTCGTCCATGCTATATTCTCGAGAATATAGCATGGACGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006028.2-1655s1c1
Sequence:CCGGCCACATCTCTACCAGTAAATACTCGAGTATTTACTGGTAGAGATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-601s1c1
Sequence:CCGGGCGTGCAGTTTAGAGACATATCTCGAGATATGTCTCTAAACTGCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-431s1c1
Sequence:CCGGCCAGCATGTTTGATGAGATTACTCGAGTAATCTCATCAAACATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-1293s1c1
Sequence:CCGGGCTTCAATCTATCAGCAACTACTCGAGTAGTTGCTGATAGATTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006028
HTR3B MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006028.3-1580s21c1
Sequence:CCGGGACCACATCTCTACCAGTAAACTCGAGTTTACTGGTAGAGATGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006028.3-1023s21c1
Sequence:CCGGAGTCCATCGTGTTGGTCAAATCTCGAGATTTGACCAACACGATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006028.3-253s21c1
Sequence:CCGGCCTGTTCGTCCATGCTATATTCTCGAGAATATAGCATGGACGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006028.2-1655s1c1
Sequence:CCGGCCACATCTCTACCAGTAAATACTCGAGTATTTACTGGTAGAGATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-601s1c1
Sequence:CCGGGCGTGCAGTTTAGAGACATATCTCGAGATATGTCTCTAAACTGCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-431s1c1
Sequence:CCGGCCAGCATGTTTGATGAGATTACTCGAGTAATCTCATCAAACATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006028.2-1293s1c1
Sequence:CCGGGCTTCAATCTATCAGCAACTACTCGAGTAGTTGCTGATAGATTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)