EMAIL THIS PAGE TO A FRIEND

HTR3C

5-hydroxytryptamine (serotonin) receptor 3C, ionotropic

53 Gene Product Result for
UniProtKB ID: Q8WXA8, A2RRR5
Gene ID:
Human(170572) Summary: The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit C of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. Genes encoding subunits C, D and E form a cluster on chromosome 3. [provided by RefSeq, Jul 2008]
cow(519394) 5-hydroxytryptamine (serotonin) receptor 3C, ionotropic
Horse(100066962) 5-hydroxytryptamine (serotonin) receptor 3C, ionotropic
dog(607416) 5-hydroxytryptamine (serotonin) receptor 3, family member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M0763 Metoclopramide hydrochloride solid human pricing
C6305 Clozapine human, rat pricing
T104 Tropisetron monohydrochloride solid, ≥98% (HPLC) human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130770 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130770 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039826 predicted 495
2 SASI_Hs01_00039827 predicted 700
3 SASI_Hs01_00039828 predicted 494
4 SASI_Hs01_00039830 predicted 476
5 SASI_Hs01_00039831 predicted 1354
6 SASI_Hs01_00039833 predicted 1390
7 SASI_Hs01_00039834 predicted 720
8 SASI_Hs02_00362787 predicted 1398
9 SASI_Hs02_00362788 predicted 721
10 SASI_Hs02_00362789 predicted 279
11 SASI_Hs01_00039825 predicted 1351
12 SASI_Hs01_00039829 predicted 401
13 SASI_Hs01_00039832 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130770
HTR3C MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 3C, ionotropic
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-360s1c1
Sequence:CCGGGCATCAATAAACTCACAGTATCTCGAGATACTGTGAGTTTATTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-772s1c1
Sequence:CCGGGCCAAGCCTCTACATCATAAACTCGAGTTTATGATGTAGAGGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-169s1c1
Sequence:CCGGCCAAGCAGTGTTTGACAGAAACTCGAGTTTCTGTCAAACACTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-1340s1c1
Sequence:CCGGTCCTCCATCCTTACTGTCATTCTCGAGAATGACAGTAAGGATGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-401s1c1
Sequence:CCGGCCAGACATCTTCATCGTGGAACTCGAGTTCCACGATGAAGATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130770
HTR3C MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 3C, ionotropic
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-360s1c1
Sequence:CCGGGCATCAATAAACTCACAGTATCTCGAGATACTGTGAGTTTATTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-772s1c1
Sequence:CCGGGCCAAGCCTCTACATCATAAACTCGAGTTTATGATGTAGAGGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-169s1c1
Sequence:CCGGCCAAGCAGTGTTTGACAGAAACTCGAGTTTCTGTCAAACACTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-1340s1c1
Sequence:CCGGTCCTCCATCCTTACTGTCATTCTCGAGAATGACAGTAAGGATGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-401s1c1
Sequence:CCGGCCAGACATCTTCATCGTGGAACTCGAGTTCCACGATGAAGATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130770
HTR3C MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 3C, ionotropic
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-360s1c1
Sequence:CCGGGCATCAATAAACTCACAGTATCTCGAGATACTGTGAGTTTATTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-772s1c1
Sequence:CCGGGCCAAGCCTCTACATCATAAACTCGAGTTTATGATGTAGAGGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-169s1c1
Sequence:CCGGCCAAGCAGTGTTTGACAGAAACTCGAGTTTCTGTCAAACACTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-1340s1c1
Sequence:CCGGTCCTCCATCCTTACTGTCATTCTCGAGAATGACAGTAAGGATGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130770.1-401s1c1
Sequence:CCGGCCAGACATCTTCATCGTGGAACTCGAGTTCCACGATGAAGATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)