EMAIL THIS PAGE TO A FRIEND

HTR3D

5-hydroxytryptamine (serotonin) receptor 3D, ionotropic

60 Gene Product Result for
Synonyms: 5HT3D
Species: Human HTR3D(200909), domestic cat HTR3D(101090286)
UniProtKB ID: Q70Z44, C9J2I6, J3QT78, Q495N5, Q495N6, Q7Z6B3
Gene ID:
Human(200909) Summary: The protein encoded this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit D of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a mitogen and a hormone. This hormone has been linked to neuropsychiatric disorders, including anxiety, depression, and migraine. Serotonin receptors causes fast and depolarizing responses in neurons following activation. The genes encoding subunits C, D and E of this type 3 receptor form a cluster on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
domestic cat(101090286) 5-hydroxytryptamine (serotonin) receptor 3D, ionotropic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M0763 Metoclopramide hydrochloride solid human pricing
C6305 Clozapine human, rat pricing
T104 Tropisetron monohydrochloride solid, ≥98% (HPLC) human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182537 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182537 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100681 predicted 418
2 SASI_Hs01_00100683 predicted 589
3 SASI_Hs01_00100684 predicted 262
4 SASI_Hs01_00100685 predicted 1104
5 SASI_Hs01_00100686 predicted 581
6 SASI_Hs01_00100687 predicted 542
7 SASI_Hs01_00100688 predicted 426
8 SASI_Hs01_00100689 predicted 582
9 SASI_Hs01_00100682 predicted 448
10 SASI_Hs01_00100690 predicted 1308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182537
HTR3D MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 3D, ionotropic
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-561s1c1
Sequence:CCGGCTAGCACTTCATCACATGCTTCTCGAGAAGCATGTGATGAAGTGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-490s1c1
Sequence:CCGGCCCATTCAAGATGACTGTTCTCTCGAGAGAACAGTCATCTTGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-255s1c1
Sequence:CCGGCATCAAACACAATAAGCCAATCTCGAGATTGGCTTATTGTGTTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-578s1c1
Sequence:CCGGGCTTCACTAGTACGTCCTCATCTCGAGATGAGGACGTACTAGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182537.2-328s21c1
Sequence:CCGGAGAGGTGAACGCTCTCCTTCACTCGAGTGAAGGAGAGCGTTCACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-407s1c1
Sequence:CCGGGTAAACTTTCTGGTGCCCAGTCTCGAGACTGGGCACCAGAAAGTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1176s21c1
Sequence:CCGGCCCAGTCCTCTGTGTAGTTTCCTCGAGGAAACTACACAGAGGACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1202s21c1
Sequence:CCGGAGACCTGAATAGTCTCCTATGCTCGAGCATAGGAGACTATTCAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1311s21c1
Sequence:CCGGTAGGGTACGTCCTTGATTAAACTCGAGTTTAATCAAGGACGTACCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182537
HTR3D MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 3D, ionotropic
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-561s1c1
Sequence:CCGGCTAGCACTTCATCACATGCTTCTCGAGAAGCATGTGATGAAGTGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-490s1c1
Sequence:CCGGCCCATTCAAGATGACTGTTCTCTCGAGAGAACAGTCATCTTGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-255s1c1
Sequence:CCGGCATCAAACACAATAAGCCAATCTCGAGATTGGCTTATTGTGTTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-578s1c1
Sequence:CCGGGCTTCACTAGTACGTCCTCATCTCGAGATGAGGACGTACTAGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182537.2-328s21c1
Sequence:CCGGAGAGGTGAACGCTCTCCTTCACTCGAGTGAAGGAGAGCGTTCACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-407s1c1
Sequence:CCGGGTAAACTTTCTGGTGCCCAGTCTCGAGACTGGGCACCAGAAAGTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1176s21c1
Sequence:CCGGCCCAGTCCTCTGTGTAGTTTCCTCGAGGAAACTACACAGAGGACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1202s21c1
Sequence:CCGGAGACCTGAATAGTCTCCTATGCTCGAGCATAGGAGACTATTCAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1311s21c1
Sequence:CCGGTAGGGTACGTCCTTGATTAAACTCGAGTTTAATCAAGGACGTACCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182537
HTR3D MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 3D, ionotropic
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-561s1c1
Sequence:CCGGCTAGCACTTCATCACATGCTTCTCGAGAAGCATGTGATGAAGTGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-490s1c1
Sequence:CCGGCCCATTCAAGATGACTGTTCTCTCGAGAGAACAGTCATCTTGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-255s1c1
Sequence:CCGGCATCAAACACAATAAGCCAATCTCGAGATTGGCTTATTGTGTTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-578s1c1
Sequence:CCGGGCTTCACTAGTACGTCCTCATCTCGAGATGAGGACGTACTAGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182537.2-328s21c1
Sequence:CCGGAGAGGTGAACGCTCTCCTTCACTCGAGTGAAGGAGAGCGTTCACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182537.1-407s1c1
Sequence:CCGGGTAAACTTTCTGGTGCCCAGTCTCGAGACTGGGCACCAGAAAGTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1176s21c1
Sequence:CCGGCCCAGTCCTCTGTGTAGTTTCCTCGAGGAAACTACACAGAGGACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1202s21c1
Sequence:CCGGAGACCTGAATAGTCTCCTATGCTCGAGCATAGGAGACTATTCAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182537.2-1311s21c1
Sequence:CCGGTAGGGTACGTCCTTGATTAAACTCGAGTTTAATCAAGGACGTACCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)