EMAIL THIS PAGE TO A FRIEND

HTR3E

5-hydroxytryptamine (serotonin) receptor 3E, ionotropic

51 Gene Product Result for
Synonyms: 5-HT3-E 5-HT3E 5-HT3c1
Gene ID:
Human(285242) Summary: This locus encodes a 5-hydroxytryptamine (serotonin) receptor subunit. The encoded protein, subunit E, may play a role in neurotransmission in myenteric neurons. Genes encoding subunits C, D and E form a cluster on chromosome 3. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2012]
Horse(100066981) 5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
cow(616094) 5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
domestic cat(101089387) 5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
dog(488102) 5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
naked mole-rat(101717686) 5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
sheep(101122747) 5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M0763 Metoclopramide hydrochloride solid human pricing
C6305 Clozapine human, rat pricing
T104 Tropisetron monohydrochloride solid, ≥98% (HPLC) human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182589 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010061 MISSION® esiRNA esiRNA targeting human HTR3E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182589 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131001 predicted 816
2 SASI_Hs01_00131002 predicted 488
3 SASI_Hs01_00131004 predicted 657
4 SASI_Hs01_00131005 predicted 1681
5 SASI_Hs01_00131006 predicted 1624
6 SASI_Hs01_00131007 predicted 848
7 SASI_Hs01_00131008 predicted 550
8 SASI_Hs01_00131009 predicted 818
9 SASI_Hs01_00131010 predicted 849
10 SASI_Hs02_00370724 predicted 774
11 SASI_Hs01_00131003 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182589
HTR3E MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182589.2-978s21c1
Sequence:CCGGCCCAGTCTCTATGTCATAAACCTCGAGGTTTATGACATAGAGACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182589.2-517s21c1
Sequence:CCGGTGGTTTGGGATAACCCATTTACTCGAGTAAATGGGTTATCCCAAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-275s1c1
Sequence:CCGGCCTTCATCTCACACATTCGATCTCGAGATCGAATGTGTGAGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-977s1c1
Sequence:CCGGGCCCAGCCTCTATGTCATAAACTCGAGTTTATGACATAGAGGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-459s1c1
Sequence:CCGGGCCATCCTAGATGTGAATGAACTCGAGTTCATTCACATCTAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-482s1c1
Sequence:CCGGGCTGCACCTCTTGTCATCATTCTCGAGAATGATGACAAGAGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-935s1c1
Sequence:CCGGCCTGTATGATCGGATCGTGTTCTCGAGAACACGATCCGATCATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182589
HTR3E MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182589.2-978s21c1
Sequence:CCGGCCCAGTCTCTATGTCATAAACCTCGAGGTTTATGACATAGAGACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182589.2-517s21c1
Sequence:CCGGTGGTTTGGGATAACCCATTTACTCGAGTAAATGGGTTATCCCAAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-275s1c1
Sequence:CCGGCCTTCATCTCACACATTCGATCTCGAGATCGAATGTGTGAGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-977s1c1
Sequence:CCGGGCCCAGCCTCTATGTCATAAACTCGAGTTTATGACATAGAGGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-459s1c1
Sequence:CCGGGCCATCCTAGATGTGAATGAACTCGAGTTCATTCACATCTAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-482s1c1
Sequence:CCGGGCTGCACCTCTTGTCATCATTCTCGAGAATGATGACAAGAGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-935s1c1
Sequence:CCGGCCTGTATGATCGGATCGTGTTCTCGAGAACACGATCCGATCATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182589
HTR3E MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 3E, ionotropic
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182589.2-978s21c1
Sequence:CCGGCCCAGTCTCTATGTCATAAACCTCGAGGTTTATGACATAGAGACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182589.2-517s21c1
Sequence:CCGGTGGTTTGGGATAACCCATTTACTCGAGTAAATGGGTTATCCCAAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-275s1c1
Sequence:CCGGCCTTCATCTCACACATTCGATCTCGAGATCGAATGTGTGAGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-977s1c1
Sequence:CCGGGCCCAGCCTCTATGTCATAAACTCGAGTTTATGACATAGAGGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-459s1c1
Sequence:CCGGGCCATCCTAGATGTGAATGAACTCGAGTTCATTCACATCTAGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-482s1c1
Sequence:CCGGGCTGCACCTCTTGTCATCATTCTCGAGAATGATGACAAGAGGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182589.1-935s1c1
Sequence:CCGGCCTGTATGATCGGATCGTGTTCTCGAGAACACGATCCGATCATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)