EMAIL THIS PAGE TO A FRIEND

HTR4

5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled

579 Gene Product Result for
Synonyms: 5-HT4 5-HT4R
Gene ID:
Human(3360) Summary: This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010]
Mouse(15562) 5 hydroxytryptamine (serotonin) receptor 4
Rat(25324) 5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
sheep(101117928) 5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
domestic guinea pig(100135548) 5 hydroxytryptamine (serotonin) receptor 4
naked mole-rat(101707865) 5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
chicken(416150) 5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
cow(317708) 5-hydroxytryptamine (serotonin) receptor 4
Horse(100034053) 5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
domestic cat(101088723) 5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
dog(489198) 5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000870 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070651 MISSION® esiRNA esiRNA human HTR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000870 Rosetta Predictions human pricing
NM_001040169 Rosetta Predictions human pricing
NM_001040171 Rosetta Predictions human pricing
NM_001040172 Rosetta Predictions human pricing
NM_001040173 Rosetta Predictions human pricing
NM_001040174 Rosetta Predictions human pricing
NM_199453 Rosetta Predictions human pricing
NM_012853 Rosetta Predictions rat pricing
NM_008313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061920 predicted 930
2 SASI_Hs02_00303400 predicted 978
3 SASI_Hs01_00061921 predicted 994
4 SASI_Hs01_00061923 predicted 227
5 SASI_Hs01_00061924 predicted 384
6 SASI_Hs01_00061925 predicted 373
7 SASI_Hs01_00061926 predicted 225
8 SASI_Hs01_00061927 predicted 246
9 SASI_Hs01_00061928 predicted 382
10 SASI_Hs01_00061929 predicted 1003
11 SASI_Hs01_00061922 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107833 predicted 933
2 SASI_Hs02_00308876 predicted 977
3 SASI_Hs01_00107834 predicted 992
4 SASI_Hs01_00107836 predicted 222
5 SASI_Hs01_00107837 predicted 392
6 SASI_Hs01_00107838 predicted 377
7 SASI_Hs01_00107839 predicted 225
8 SASI_Hs01_00107840 predicted 238
9 SASI_Hs01_00107841 predicted 384
10 SASI_Hs01_00107842 predicted 1007
11 SASI_Hs01_00107835 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134659 predicted 936
2 SASI_Hs02_00308877 predicted 980
3 SASI_Hs01_00134660 predicted 994
4 SASI_Hs01_00134662 predicted 222
5 SASI_Hs01_00134663 predicted 392
6 SASI_Hs01_00134664 predicted 378
7 SASI_Hs01_00134665 predicted 226
8 SASI_Hs01_00134666 predicted 237
9 SASI_Hs01_00134667 predicted 386
10 SASI_Hs01_00134668 predicted 1004
11 SASI_Hs01_00134661 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209890 predicted 976
2 SASI_Hs02_00308878 predicted 1017
3 SASI_Hs01_00209891 predicted 1030
4 SASI_Hs01_00209893 predicted 225
5 SASI_Hs01_00209894 predicted 384
6 SASI_Hs01_00209895 predicted 374
7 SASI_Hs01_00209896 predicted 228
8 SASI_Hs01_00209897 predicted 245
9 SASI_Hs01_00209898 predicted 385
10 SASI_Hs01_00209899 predicted 1043
11 SASI_Hs01_00209892 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068839 predicted 936
2 SASI_Hs02_00308879 predicted 973
3 SASI_Hs01_00068840 predicted 987
4 SASI_Hs01_00068842 predicted 225
5 SASI_Hs01_00068843 predicted 386
6 SASI_Hs01_00068844 predicted 373
7 SASI_Hs01_00068845 predicted 229
8 SASI_Hs01_00068846 predicted 244
9 SASI_Hs01_00068847 predicted 380
10 SASI_Hs01_00068848 predicted 1004
11 SASI_Hs01_00068841 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222102 predicted 935
2 SASI_Hs01_00222103 predicted 974
3 SASI_Hs01_00222104 predicted 992
4 SASI_Hs01_00222106 predicted 219
5 SASI_Hs01_00222107 predicted 385
6 SASI_Hs01_00222108 predicted 374
7 SASI_Hs01_00222109 predicted 228
8 SASI_Hs01_00222110 predicted 237
9 SASI_Hs01_00222111 predicted 383
10 SASI_Hs02_00308880 predicted 1003
11 SASI_Hs01_00222105 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130731 predicted 930
2 SASI_Hs01_00130732 predicted 976
3 SASI_Hs01_00130733 predicted 988
4 SASI_Hs01_00130735 predicted 220
5 SASI_Hs01_00130736 predicted 384
6 SASI_Hs01_00130737 predicted 378
7 SASI_Hs01_00130738 predicted 232
8 SASI_Hs01_00130739 predicted 244
9 SASI_Hs01_00130740 predicted 386
10 SASI_Hs02_00372860 predicted 998
11 SASI_Hs01_00130734 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057145 predicted 317
2 SASI_Rn01_00057146 predicted 529
3 SASI_Rn01_00057147 predicted 849
4 SASI_Rn01_00057149 predicted 544
5 SASI_Rn01_00057150 predicted 643
6 SASI_Rn01_00057151 predicted 246
7 SASI_Rn01_00057152 predicted 941
8 SASI_Rn01_00057153 predicted 779
9 SASI_Rn01_00057154 predicted 659
10 SASI_Rn02_00260328 predicted 387
11 SASI_Rn01_00057148 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116377 predicted 1042
2 SASI_Mm01_00116378 predicted 726
3 SASI_Mm01_00116379 predicted 1135
4 SASI_Mm01_00116380 predicted 1261
5 SASI_Mm01_00116381 predicted 840
6 SASI_Mm01_00116382 predicted 1423
7 SASI_Mm01_00116383 predicted 848
8 SASI_Mm01_00116384 predicted 771
9 SASI_Mm01_00116385 predicted 510
10 SASI_Mm01_00116386 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000870
HTR4 MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-1076s1c1
Sequence:CCGGCGCCTTCTTGAATAAGTCTTTCTCGAGAAAGACTTATTCAAGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-1040s1c1
Sequence:CCGGCGGCTATATCAATTCCGGGTTCTCGAGAACCCGGAATTGATATAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000870.2-1661s1c1
Sequence:CCGGCGGTCACTGATGTCTCCAAATCTCGAGATTTGGAGACATCAGTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-957s1c1
Sequence:CCGGGCACCATTCTTTGTCACCAATCTCGAGATTGGTGACAAAGAATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-606s1c1
Sequence:CCGGCCTATAATGCAAGGCTGGAATCTCGAGATTCCAGCCTTGCATTATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-233s21c1
Sequence:CCGGCACGTTTCTCTCGACGGTTATCTCGAGATAACCGTCGAGAGAAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-783s21c1
Sequence:CCGGCTCATGGTGCTGGCCTATTACCTCGAGGTAATAGGCCAGCACCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-645s21c1
Sequence:CCGGTGGAATAACATTGGCATAATTCTCGAGAATTATGCCAATGTTATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-566s21c1
Sequence:CCGGCCCTCTGCGCATCGCATTAATCTCGAGATTAATGCGATGCGCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000870
HTR4 MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-1076s1c1
Sequence:CCGGCGCCTTCTTGAATAAGTCTTTCTCGAGAAAGACTTATTCAAGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-1040s1c1
Sequence:CCGGCGGCTATATCAATTCCGGGTTCTCGAGAACCCGGAATTGATATAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000870.2-1661s1c1
Sequence:CCGGCGGTCACTGATGTCTCCAAATCTCGAGATTTGGAGACATCAGTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-957s1c1
Sequence:CCGGGCACCATTCTTTGTCACCAATCTCGAGATTGGTGACAAAGAATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-606s1c1
Sequence:CCGGCCTATAATGCAAGGCTGGAATCTCGAGATTCCAGCCTTGCATTATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-233s21c1
Sequence:CCGGCACGTTTCTCTCGACGGTTATCTCGAGATAACCGTCGAGAGAAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-783s21c1
Sequence:CCGGCTCATGGTGCTGGCCTATTACCTCGAGGTAATAGGCCAGCACCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-645s21c1
Sequence:CCGGTGGAATAACATTGGCATAATTCTCGAGAATTATGCCAATGTTATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-566s21c1
Sequence:CCGGCCCTCTGCGCATCGCATTAATCTCGAGATTAATGCGATGCGCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000870
HTR4 MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-1076s1c1
Sequence:CCGGCGCCTTCTTGAATAAGTCTTTCTCGAGAAAGACTTATTCAAGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-1040s1c1
Sequence:CCGGCGGCTATATCAATTCCGGGTTCTCGAGAACCCGGAATTGATATAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000870.2-1661s1c1
Sequence:CCGGCGGTCACTGATGTCTCCAAATCTCGAGATTTGGAGACATCAGTGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-957s1c1
Sequence:CCGGGCACCATTCTTTGTCACCAATCTCGAGATTGGTGACAAAGAATGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000870.2-606s1c1
Sequence:CCGGCCTATAATGCAAGGCTGGAATCTCGAGATTCCAGCCTTGCATTATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-233s21c1
Sequence:CCGGCACGTTTCTCTCGACGGTTATCTCGAGATAACCGTCGAGAGAAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-783s21c1
Sequence:CCGGCTCATGGTGCTGGCCTATTACCTCGAGGTAATAGGCCAGCACCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-645s21c1
Sequence:CCGGTGGAATAACATTGGCATAATTCTCGAGAATTATGCCAATGTTATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000870.4-566s21c1
Sequence:CCGGCCCTCTGCGCATCGCATTAATCTCGAGATTAATGCGATGCGCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008313
HTR4 MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-629s1c1
Sequence:CCGGGCTGGCCTATTACCGAATCTACTCGAGTAGATTCGGTAATAGGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-822s1c1
Sequence:CCGGCCCTTCTTTGTCACCAATATTCTCGAGAATATTGGTGACAAAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-377s1c1
Sequence:CCGGGCCTTTGGTTTATAGGAACAACTCGAGTTGTTCCTATAAACCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-443s1c1
Sequence:CCGGCCTTCCCATGTTTATATCTTTCTCGAGAAAGATATAAACATGGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-1121s1c1
Sequence:CCGGCCTCACAGCAACTTCTCCTTTCTCGAGAAAGGAGAAGTTGCTGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008313
HTR4 MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-629s1c1
Sequence:CCGGGCTGGCCTATTACCGAATCTACTCGAGTAGATTCGGTAATAGGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-822s1c1
Sequence:CCGGCCCTTCTTTGTCACCAATATTCTCGAGAATATTGGTGACAAAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-377s1c1
Sequence:CCGGGCCTTTGGTTTATAGGAACAACTCGAGTTGTTCCTATAAACCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-443s1c1
Sequence:CCGGCCTTCCCATGTTTATATCTTTCTCGAGAAAGATATAAACATGGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-1121s1c1
Sequence:CCGGCCTCACAGCAACTTCTCCTTTCTCGAGAAAGGAGAAGTTGCTGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008313
HTR4 MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-629s1c1
Sequence:CCGGGCTGGCCTATTACCGAATCTACTCGAGTAGATTCGGTAATAGGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-822s1c1
Sequence:CCGGCCCTTCTTTGTCACCAATATTCTCGAGAATATTGGTGACAAAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-377s1c1
Sequence:CCGGGCCTTTGGTTTATAGGAACAACTCGAGTTGTTCCTATAAACCAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-443s1c1
Sequence:CCGGCCTTCCCATGTTTATATCTTTCTCGAGAAAGATATAAACATGGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008313.1-1121s1c1
Sequence:CCGGCCTCACAGCAACTTCTCCTTTCTCGAGAAAGGAGAAGTTGCTGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)