EMAIL THIS PAGE TO A FRIEND

HTR5A

5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled

137 Gene Product Result for
Synonyms: 5-HT5A
UniProtKB ID: P47898, Q2M2D2
Gene ID:
Human(3361) Summary: The neurotransmitter serotonin (5-hydroxytryptamine, 5-HT) has been implicated in a wide range of psychiatric conditions and also has vasoconstrictive and vasodilatory effects. The gene described in this record is a member of 5-hydroxytryptamine (serotonin) receptor family and encodes a multi-pass membrane protein that functions as a receptor for 5-hydroxytryptamine and couples to G-proteins. This protein has been shown to function in part through the regulation of intracellular Ca2+ mobilization. [provided by RefSeq, Jul 2008]
Mouse(15563) 5-hydroxytryptamine (serotonin) receptor 5A
Rat(25689) 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Zebrafish(100038775) 5-hydroxytryptamine (serotonin) receptor 5A
chicken(428409) 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
cow(541200) 5-hydroxytryptamine (serotonin) receptor 5A
Horse(100063709) 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
domestic cat(101084611) 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
dog(482814) 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
domestic guinea pig(100379278) 5-hydroxytryptamine (serotonin) receptor 5A
naked mole-rat(101723065) 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
sheep(101116905) 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M1626 6-Methoxyharmalan crystalline human, rat pricing
51330 Harmaline ≥95% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024012 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104651 MISSION® esiRNA esiRNA human HTR5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024012 Rosetta Predictions human pricing
NM_013148 Rosetta Predictions rat pricing
NM_008314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090509 predicted 704
2 SASI_Hs01_00090510 predicted 1326
3 SASI_Hs01_00090511 predicted 1297
4 SASI_Hs01_00090512 predicted 1449
5 SASI_Hs01_00090513 predicted 1313
6 SASI_Hs01_00090514 predicted 1376
7 SASI_Hs02_00356438 predicted 1167
8 SASI_Hs01_00090515 predicted 1214
9 SASI_Hs01_00090516 predicted 488
10 SASI_Hs01_00090517 predicted 518
11 SASI_Hs01_00090518 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086325 predicted 1635
2 SASI_Rn02_00260949 predicted 1336
3 SASI_Rn01_00086326 predicted 684
4 SASI_Rn01_00086328 predicted 1515
5 SASI_Rn01_00086329 predicted 1601
6 SASI_Rn01_00086330 predicted 543
7 SASI_Rn02_00260950 predicted 976
8 SASI_Rn01_00086331 predicted 1572
9 SASI_Rn01_00086332 predicted 395
10 SASI_Rn01_00086333 predicted 1118
11 SASI_Rn01_00086327 predicted 1674
12 SASI_Rn01_00086334 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104429 predicted 1041
2 SASI_Mm01_00104430 predicted 1615
3 SASI_Mm01_00104431 predicted 1504
4 SASI_Mm01_00104432 predicted 642
5 SASI_Mm01_00104433 predicted 1597
6 SASI_Mm01_00104434 predicted 1180
7 SASI_Mm01_00104435 predicted 1474
8 SASI_Mm01_00104436 predicted 894
9 SASI_Mm01_00104437 predicted 1336
10 SASI_Mm01_00104438 predicted 1561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008314
HTR5A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008314.2-1020s21c1
Sequence:CCGGCTCTGGCTCCACTGCTATTTGCTCGAGCAAATAGCAGTGGAGCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-885s1c1
Sequence:CCGGGCATCTGGAATGTGACAGCAACTCGAGTTGCTGTCACATTCCAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008314.2-1609s21c1
Sequence:CCGGTTGTAGCTCAGTGGGTTATATCTCGAGATATAACCCACTGAGCTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-967s1c1
Sequence:CCGGGCGTGTCTCCAATGTGATGATCTCGAGATCATCACATTGGAGACACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1090s1c1
Sequence:CCGGCGAGCCTTCCTACACCGTGTTCTCGAGAACACGGTGTAGGAAGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1471s1c1
Sequence:CCGGCCTGTGGTTGGGCTATTCTAACTCGAGTTAGAATAGCCCAACCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1504s1c1
Sequence:CCGGCCCACTCATCTACACAGCATTCTCGAGAATGCTGTGTAGATGAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008314
HTR5A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008314.2-1020s21c1
Sequence:CCGGCTCTGGCTCCACTGCTATTTGCTCGAGCAAATAGCAGTGGAGCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-885s1c1
Sequence:CCGGGCATCTGGAATGTGACAGCAACTCGAGTTGCTGTCACATTCCAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008314.2-1609s21c1
Sequence:CCGGTTGTAGCTCAGTGGGTTATATCTCGAGATATAACCCACTGAGCTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-967s1c1
Sequence:CCGGGCGTGTCTCCAATGTGATGATCTCGAGATCATCACATTGGAGACACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1090s1c1
Sequence:CCGGCGAGCCTTCCTACACCGTGTTCTCGAGAACACGGTGTAGGAAGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1471s1c1
Sequence:CCGGCCTGTGGTTGGGCTATTCTAACTCGAGTTAGAATAGCCCAACCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1504s1c1
Sequence:CCGGCCCACTCATCTACACAGCATTCTCGAGAATGCTGTGTAGATGAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008314
HTR5A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008314.2-1020s21c1
Sequence:CCGGCTCTGGCTCCACTGCTATTTGCTCGAGCAAATAGCAGTGGAGCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-885s1c1
Sequence:CCGGGCATCTGGAATGTGACAGCAACTCGAGTTGCTGTCACATTCCAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008314.2-1609s21c1
Sequence:CCGGTTGTAGCTCAGTGGGTTATATCTCGAGATATAACCCACTGAGCTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-967s1c1
Sequence:CCGGGCGTGTCTCCAATGTGATGATCTCGAGATCATCACATTGGAGACACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1090s1c1
Sequence:CCGGCGAGCCTTCCTACACCGTGTTCTCGAGAACACGGTGTAGGAAGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1471s1c1
Sequence:CCGGCCTGTGGTTGGGCTATTCTAACTCGAGTTAGAATAGCCCAACCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008314.1-1504s1c1
Sequence:CCGGCCCACTCATCTACACAGCATTCTCGAGAATGCTGTGTAGATGAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024012
HTR5A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024012.2-173s21c1
Sequence:CCGGTCGGTCTTCGGAGTGCTTATTCTCGAGAATAAGCACTCCGAAGACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024012.2-1331s21c1
Sequence:CCGGGACATGATGTATCTAACTTATCTCGAGATAAGTTAGATACATCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-117s1c1
Sequence:CCGGCGGAGTGCTTATTCTCACCTTCTCGAGAAGGTGAGAATAAGCACTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024012.2-1607s21c1
Sequence:CCGGTCCTAGTACATATATCCTAATCTCGAGATTAGGATATATGTACTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024012.2-1044s21c1
Sequence:CCGGGCTACTCCAACTCCTTCTTTACTCGAGTAAAGAAGGAGTTGGAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-588s1c1
Sequence:CCGGCGAGCCTTCCTACGCCGTGTTCTCGAGAACACGGCGTAGGAAGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-651s1c1
Sequence:CCGGCTTCGTGTACTGGAAGATCTACTCGAGTAGATCTTCCAGTACACGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-707s1c1
Sequence:CCGGCCAATAGCGTCTCACCCATATCTCGAGATATGGGTGAGACGCTATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-106s1c1
Sequence:CCGGCTCTCGGTCTTCGGAGTGCTTCTCGAGAAGCACTCCGAAGACCGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024012
HTR5A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024012.2-173s21c1
Sequence:CCGGTCGGTCTTCGGAGTGCTTATTCTCGAGAATAAGCACTCCGAAGACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024012.2-1331s21c1
Sequence:CCGGGACATGATGTATCTAACTTATCTCGAGATAAGTTAGATACATCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-117s1c1
Sequence:CCGGCGGAGTGCTTATTCTCACCTTCTCGAGAAGGTGAGAATAAGCACTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024012.2-1607s21c1
Sequence:CCGGTCCTAGTACATATATCCTAATCTCGAGATTAGGATATATGTACTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024012.2-1044s21c1
Sequence:CCGGGCTACTCCAACTCCTTCTTTACTCGAGTAAAGAAGGAGTTGGAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-588s1c1
Sequence:CCGGCGAGCCTTCCTACGCCGTGTTCTCGAGAACACGGCGTAGGAAGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-651s1c1
Sequence:CCGGCTTCGTGTACTGGAAGATCTACTCGAGTAGATCTTCCAGTACACGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-707s1c1
Sequence:CCGGCCAATAGCGTCTCACCCATATCTCGAGATATGGGTGAGACGCTATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-106s1c1
Sequence:CCGGCTCTCGGTCTTCGGAGTGCTTCTCGAGAAGCACTCCGAAGACCGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024012
HTR5A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024012.2-173s21c1
Sequence:CCGGTCGGTCTTCGGAGTGCTTATTCTCGAGAATAAGCACTCCGAAGACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024012.2-1331s21c1
Sequence:CCGGGACATGATGTATCTAACTTATCTCGAGATAAGTTAGATACATCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-117s1c1
Sequence:CCGGCGGAGTGCTTATTCTCACCTTCTCGAGAAGGTGAGAATAAGCACTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024012.2-1607s21c1
Sequence:CCGGTCCTAGTACATATATCCTAATCTCGAGATTAGGATATATGTACTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024012.2-1044s21c1
Sequence:CCGGGCTACTCCAACTCCTTCTTTACTCGAGTAAAGAAGGAGTTGGAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-588s1c1
Sequence:CCGGCGAGCCTTCCTACGCCGTGTTCTCGAGAACACGGCGTAGGAAGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-651s1c1
Sequence:CCGGCTTCGTGTACTGGAAGATCTACTCGAGTAGATCTTCCAGTACACGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-707s1c1
Sequence:CCGGCCAATAGCGTCTCACCCATATCTCGAGATATGGGTGAGACGCTATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024012.1-106s1c1
Sequence:CCGGCTCTCGGTCTTCGGAGTGCTTCTCGAGAAGCACTCCGAAGACCGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)