EMAIL THIS PAGE TO A FRIEND

HTR6

5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled

75 Gene Product Result for
Synonyms: 5-HT6 5-HT6R
UniProtKB ID: P50406, Q13640, Q5TGZ1
Gene ID:
Mouse(15565) 5-hydroxytryptamine (serotonin) receptor 6
Rat(64354) 5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Zebrafish(335896) 5-hydroxytryptamine (serotonin) receptor 6
domestic cat(101091032) 5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
cow(512167) 5-hydroxytryptamine (serotonin) receptor 6
dog(487402) 5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
chicken(430019) 5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
sheep(101104894) 5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
domestic guinea pig(100723275) 5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
naked mole-rat(101708777) 5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900617 Anti-HTR6/5-HT36 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2900618 Anti-HTR6/5-HT36 antibody produced in rabbit affinity isolated antibody hamster, human, rat, horse, dog, monkey
immunohistochemistry pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M6628 O-Methylserotonin hydrochloride crystalline human pricing
Q1004 Quipazine maleate salt human pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
M2381 5-Methoxy-N,N-dimethyltryptamine human, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061571 MISSION® esiRNA esiRNA targeting mouse Htr6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000871 Rosetta Predictions human pricing
NM_024365 Rosetta Predictions rat pricing
NM_021358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094518 predicted 1069
2 SASI_Hs01_00094519 predicted 1425
3 SASI_Hs01_00094520 predicted 1270
4 SASI_Hs01_00094521 predicted 1220
5 SASI_Hs01_00094522 predicted 1386
6 SASI_Hs01_00094523 predicted 1373
7 SASI_Hs01_00094524 predicted 1085
8 SASI_Hs01_00094525 predicted 1384
9 SASI_Hs01_00094526 predicted 1712
10 SASI_Hs01_00094527 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102217 predicted 913
2 SASI_Rn01_00102218 predicted 1579
3 SASI_Rn01_00102219 predicted 860
4 SASI_Rn01_00102220 predicted 484
5 SASI_Rn01_00102221 predicted 561
6 SASI_Rn01_00102222 predicted 966
7 SASI_Rn01_00102223 predicted 1051
8 SASI_Rn01_00102224 predicted 489
9 SASI_Rn02_00263950 predicted 1216
10 SASI_Rn01_00102225 predicted 578
11 SASI_Rn01_00102226 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131182 predicted 845
2 SASI_Mm01_00131183 predicted 566
3 SASI_Mm01_00131184 predicted 947
4 SASI_Mm01_00131185 predicted 263
5 SASI_Mm01_00131186 predicted 683
6 SASI_Mm01_00131187 predicted 198
7 SASI_Mm01_00131188 predicted 948
8 SASI_Mm01_00131189 predicted 891
9 SASI_Mm01_00131190 predicted 786
10 SASI_Mm01_00131191 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000871
HTR6 MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1315s21c1
Sequence:CCGGCCTTCTTTGTGGCCAACATAGCTCGAGCTATGTTGGCCACAAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1395s21c1
Sequence:CCGGTACTGTAACAGCACCATGAACCTCGAGGTTCATGGTGCTGTTACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1429s21c1
Sequence:CCGGCACTCTTCATGCGGGACTTCACTCGAGTGAAGTCCCGCATGAAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-860s1c1
Sequence:CCGGGCTGCGCTACAAGCTGCGCATCTCGAGATGCGCAGCTTGTAGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-638s1c1
Sequence:CCGGGCGCAACACGTCCAACTTCTTCTCGAGAAGAAGTTGGACGTGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1427s1c1
Sequence:CCGGCCCACTCTTCATGCGGGACTTCTCGAGAAGTCCCGCATGAAGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1715s1c1
Sequence:CCGGCGCCGTCAATTTCTTCAACATCTCGAGATGTTGAAGAAATTGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1291s1c1
Sequence:CCGGGCATGTTCTTTGTGACCTGGTCTCGAGACCAGGTCACAAAGAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000871
HTR6 MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1315s21c1
Sequence:CCGGCCTTCTTTGTGGCCAACATAGCTCGAGCTATGTTGGCCACAAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1395s21c1
Sequence:CCGGTACTGTAACAGCACCATGAACCTCGAGGTTCATGGTGCTGTTACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1429s21c1
Sequence:CCGGCACTCTTCATGCGGGACTTCACTCGAGTGAAGTCCCGCATGAAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-860s1c1
Sequence:CCGGGCTGCGCTACAAGCTGCGCATCTCGAGATGCGCAGCTTGTAGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-638s1c1
Sequence:CCGGGCGCAACACGTCCAACTTCTTCTCGAGAAGAAGTTGGACGTGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1427s1c1
Sequence:CCGGCCCACTCTTCATGCGGGACTTCTCGAGAAGTCCCGCATGAAGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1715s1c1
Sequence:CCGGCGCCGTCAATTTCTTCAACATCTCGAGATGTTGAAGAAATTGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1291s1c1
Sequence:CCGGGCATGTTCTTTGTGACCTGGTCTCGAGACCAGGTCACAAAGAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000871
HTR6 MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1315s21c1
Sequence:CCGGCCTTCTTTGTGGCCAACATAGCTCGAGCTATGTTGGCCACAAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1395s21c1
Sequence:CCGGTACTGTAACAGCACCATGAACCTCGAGGTTCATGGTGCTGTTACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000871.1-1429s21c1
Sequence:CCGGCACTCTTCATGCGGGACTTCACTCGAGTGAAGTCCCGCATGAAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-860s1c1
Sequence:CCGGGCTGCGCTACAAGCTGCGCATCTCGAGATGCGCAGCTTGTAGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-638s1c1
Sequence:CCGGGCGCAACACGTCCAACTTCTTCTCGAGAAGAAGTTGGACGTGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1427s1c1
Sequence:CCGGCCCACTCTTCATGCGGGACTTCTCGAGAAGTCCCGCATGAAGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1715s1c1
Sequence:CCGGCGCCGTCAATTTCTTCAACATCTCGAGATGTTGAAGAAATTGACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000871.1-1291s1c1
Sequence:CCGGGCATGTTCTTTGTGACCTGGTCTCGAGACCAGGTCACAAAGAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021358
HTR6 MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-894s1c1
Sequence:CCGGCCAGCATAGCTCAGGCCGTATCTCGAGATACGGCCTGAGCTATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-933s1c1
Sequence:CCGGGTCTCTTCGATGTCCTCACATCTCGAGATGTGAGGACATCGAAGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-275s1c1
Sequence:CCGGGCCATGCTGAACGCGCTGTATCTCGAGATACAGCGCGTTCAGCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-199s1c1
Sequence:CCGGGCGCAACACGTCTAACTTCTTCTCGAGAAGAAGTTAGACGTGTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-1160s1c1
Sequence:CCGGCCCAACTCAGATTCAGACTCACTCGAGTGAGTCTGAATCTGAGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021358
HTR6 MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-894s1c1
Sequence:CCGGCCAGCATAGCTCAGGCCGTATCTCGAGATACGGCCTGAGCTATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-933s1c1
Sequence:CCGGGTCTCTTCGATGTCCTCACATCTCGAGATGTGAGGACATCGAAGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-275s1c1
Sequence:CCGGGCCATGCTGAACGCGCTGTATCTCGAGATACAGCGCGTTCAGCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-199s1c1
Sequence:CCGGGCGCAACACGTCTAACTTCTTCTCGAGAAGAAGTTAGACGTGTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-1160s1c1
Sequence:CCGGCCCAACTCAGATTCAGACTCACTCGAGTGAGTCTGAATCTGAGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021358
HTR6 MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-894s1c1
Sequence:CCGGCCAGCATAGCTCAGGCCGTATCTCGAGATACGGCCTGAGCTATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-933s1c1
Sequence:CCGGGTCTCTTCGATGTCCTCACATCTCGAGATGTGAGGACATCGAAGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-275s1c1
Sequence:CCGGGCCATGCTGAACGCGCTGTATCTCGAGATACAGCGCGTTCAGCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-199s1c1
Sequence:CCGGGCGCAACACGTCTAACTTCTTCTCGAGAAGAAGTTAGACGTGTTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021358.1-1160s1c1
Sequence:CCGGCCCAACTCAGATTCAGACTCACTCGAGTGAGTCTGAATCTGAGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)