EMAIL THIS PAGE TO A FRIEND

HTR7

5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled

273 Gene Product Result for
Synonyms: 5-HT7
Gene ID:
Human(3363) Summary: The neurotransmitter, serotonin, is thought to play a role in various cognitive and behavioral functions. The serotonin receptor encoded by this gene belongs to the superfamily of G protein-coupled receptors and the gene is a candidate locus for involvement in autistic disorder and other neuropsychiatric disorders. Three splice variants have been identified which encode proteins that differ in the length of their carboxy terminal ends. [provided by RefSeq, Jul 2008]
Mouse(15566) 5-hydroxytryptamine (serotonin) receptor 7
Rat(65032) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
domestic guinea pig(100135549) 5-hydroxytryptamine (serotonin) receptor 7
naked mole-rat(101719078) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
sheep(101122994) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Domestic Rabbit(100009356) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
chicken(423794) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
cow(538510) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Horse(100009688) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
domestic cat(101092146) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
dog(477762) 5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M6628 O-Methylserotonin hydrochloride crystalline human pricing
Q1004 Quipazine maleate salt human pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000872 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071661 MISSION® esiRNA esiRNA human HTR7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000872 Rosetta Predictions human pricing
NM_019859 Rosetta Predictions human pricing
NM_019860 Rosetta Predictions human pricing
NM_022938 Rosetta Predictions rat pricing
NM_008315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137321 predicted 945
2 SASI_Hs01_00137322 predicted 1826
3 SASI_Hs01_00137323 predicted 878
4 SASI_Hs01_00137324 predicted 1185
5 SASI_Hs01_00137325 predicted 2028
6 SASI_Hs01_00137326 predicted 1824
7 SASI_Hs01_00137327 predicted 947
8 SASI_Hs01_00137328 predicted 846
9 SASI_Hs01_00137329 predicted 916
10 SASI_Hs02_00303401 predicted 898
11 SASI_Hs01_00137330 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023946 predicted 944
2 SASI_Hs01_00023947 predicted 1959
3 SASI_Hs01_00023948 predicted 873
4 SASI_Hs01_00023949 predicted 1187
5 SASI_Hs01_00023950 predicted 2165
6 SASI_Hs01_00023951 predicted 1955
7 SASI_Hs01_00023952 predicted 946
8 SASI_Hs01_00023953 predicted 848
9 SASI_Hs01_00023954 predicted 916
10 SASI_Hs02_00352887 predicted 904
11 SASI_Hs01_00023955 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108378 predicted 942
2 SASI_Hs01_00108379 predicted 1874
3 SASI_Hs01_00108380 predicted 875
4 SASI_Hs01_00108381 predicted 1183
5 SASI_Hs01_00108382 predicted 1868
6 SASI_Hs01_00108383 predicted 945
7 SASI_Hs01_00108384 predicted 846
8 SASI_Hs01_00108385 predicted 918
9 SASI_Hs02_00352888 predicted 904
10 SASI_Hs01_00108386 predicted 886
11 SASI_Hs01_00108387 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263644 predicted 557
2 SASI_Rn02_00263645 predicted 1018
3 SASI_Rn02_00263646 predicted 575
4 SASI_Rn02_00263647 predicted 767
5 SASI_Rn02_00263648 predicted 459
6 SASI_Rn02_00263649 predicted 877
7 SASI_Rn02_00263650 predicted 790
8 SASI_Rn01_00086901 predicted 805
9 SASI_Rn02_00263651 predicted 985
10 SASI_Rn02_00263652 predicted 774
11 SASI_Rn01_00086898 predicted 1519
12 SASI_Rn01_00086899 predicted 1364
13 SASI_Rn01_00086900 predicted 1705
14 SASI_Rn01_00086902 predicted 1660
15 SASI_Rn01_00086903 predicted 1239
16 SASI_Rn01_00086904 predicted 820
17 SASI_Rn01_00086905 predicted 1019
18 SASI_Rn01_00086906 predicted 1550
19 SASI_Rn01_00086907 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065136 predicted 547
2 SASI_Mm02_00313627 predicted 1390
3 SASI_Mm01_00065137 predicted 1286
4 SASI_Mm01_00065138 predicted 1011
5 SASI_Mm02_00313628 predicted 1925
6 SASI_Mm01_00065141 predicted 331
7 SASI_Mm01_00065142 predicted 1164
8 SASI_Mm01_00065144 predicted 869
9 SASI_Mm02_00313629 predicted 1927
10 SASI_Mm01_00065145 predicted 796
11 SASI_Mm01_00065139 predicted 573
12 SASI_Mm01_00065140 predicted 764
13 SASI_Mm01_00065143 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008315
HTR7 MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-882s1c1
Sequence:CCGGGCTGTTCATGTACTATCAGATCTCGAGATCTGATAGTACATGAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-1235s1c1
Sequence:CCGGGCTATGCAAACTCTCTCATTACTCGAGTAATGAGAGAGTTTGCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-570s1c1
Sequence:CCGGCCACTTCTTCTGCAACGTCTTCTCGAGAAGACGTTGCAGAAGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-795s1c1
Sequence:CCGGCGATGACAAAGTGTGCTTGATCTCGAGATCAAGCACACTTTGTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-357s1c1
Sequence:CCGGGAAAGTTGTGATCGGCTCCATCTCGAGATGGAGCCGATCACAACTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008315
HTR7 MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-882s1c1
Sequence:CCGGGCTGTTCATGTACTATCAGATCTCGAGATCTGATAGTACATGAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-1235s1c1
Sequence:CCGGGCTATGCAAACTCTCTCATTACTCGAGTAATGAGAGAGTTTGCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-570s1c1
Sequence:CCGGCCACTTCTTCTGCAACGTCTTCTCGAGAAGACGTTGCAGAAGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-795s1c1
Sequence:CCGGCGATGACAAAGTGTGCTTGATCTCGAGATCAAGCACACTTTGTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-357s1c1
Sequence:CCGGGAAAGTTGTGATCGGCTCCATCTCGAGATGGAGCCGATCACAACTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008315
HTR7 MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-882s1c1
Sequence:CCGGGCTGTTCATGTACTATCAGATCTCGAGATCTGATAGTACATGAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-1235s1c1
Sequence:CCGGGCTATGCAAACTCTCTCATTACTCGAGTAATGAGAGAGTTTGCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-570s1c1
Sequence:CCGGCCACTTCTTCTGCAACGTCTTCTCGAGAAGACGTTGCAGAAGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-795s1c1
Sequence:CCGGCGATGACAAAGTGTGCTTGATCTCGAGATCAAGCACACTTTGTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008315.1-357s1c1
Sequence:CCGGGAAAGTTGTGATCGGCTCCATCTCGAGATGGAGCCGATCACAACTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000872
HTR7 MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000872.3-1794s1c1
Sequence:CCGGGCACACCAACAGAACTGAGTTCTCGAGAACTCAGTTCTGTTGGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-945s1c1
Sequence:CCGGCCAGGACTTTGGCTATACGATCTCGAGATCGTATAGCCAAAGTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-1523s1c1
Sequence:CCGGGACCTGAGTTTGTGCTACAAACTCGAGTTTGTAGCACAAACTCAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-1449s1c1
Sequence:CCGGGTACCGGAATATCAACCGGAACTCGAGTTCCGGTTGATATTCCGGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-907s1c1
Sequence:CCGGGCTCAGAATGTAAATGATGATCTCGAGATCATCATTTACATTCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000872.4-1721s21c1
Sequence:CCGGCTGTTGTACACACTATCTTATCTCGAGATAAGATAGTGTGTACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000872.4-967s21c1
Sequence:CCGGTACTCTACCGCAGTGGCATTTCTCGAGAAATGCCACTGCGGTAGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000872.4-881s21c1
Sequence:CCGGTCACCTTACCTCCACTCTTTGCTCGAGCAAAGAGTGGAGGTAAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000872.4-2071s21c1
Sequence:CCGGGAATCCAGTCATCAGCTAATACTCGAGTATTAGCTGATGACTGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000872
HTR7 MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000872.3-1794s1c1
Sequence:CCGGGCACACCAACAGAACTGAGTTCTCGAGAACTCAGTTCTGTTGGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-945s1c1
Sequence:CCGGCCAGGACTTTGGCTATACGATCTCGAGATCGTATAGCCAAAGTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-1523s1c1
Sequence:CCGGGACCTGAGTTTGTGCTACAAACTCGAGTTTGTAGCACAAACTCAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-1449s1c1
Sequence:CCGGGTACCGGAATATCAACCGGAACTCGAGTTCCGGTTGATATTCCGGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-907s1c1
Sequence:CCGGGCTCAGAATGTAAATGATGATCTCGAGATCATCATTTACATTCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000872.4-1721s21c1
Sequence:CCGGCTGTTGTACACACTATCTTATCTCGAGATAAGATAGTGTGTACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000872.4-967s21c1
Sequence:CCGGTACTCTACCGCAGTGGCATTTCTCGAGAAATGCCACTGCGGTAGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000872.4-881s21c1
Sequence:CCGGTCACCTTACCTCCACTCTTTGCTCGAGCAAAGAGTGGAGGTAAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000872.4-2071s21c1
Sequence:CCGGGAATCCAGTCATCAGCTAATACTCGAGTATTAGCTGATGACTGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000872
HTR7 MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000872.3-1794s1c1
Sequence:CCGGGCACACCAACAGAACTGAGTTCTCGAGAACTCAGTTCTGTTGGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-945s1c1
Sequence:CCGGCCAGGACTTTGGCTATACGATCTCGAGATCGTATAGCCAAAGTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-1523s1c1
Sequence:CCGGGACCTGAGTTTGTGCTACAAACTCGAGTTTGTAGCACAAACTCAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-1449s1c1
Sequence:CCGGGTACCGGAATATCAACCGGAACTCGAGTTCCGGTTGATATTCCGGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000872.3-907s1c1
Sequence:CCGGGCTCAGAATGTAAATGATGATCTCGAGATCATCATTTACATTCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000872.4-1721s21c1
Sequence:CCGGCTGTTGTACACACTATCTTATCTCGAGATAAGATAGTGTGTACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000872.4-967s21c1
Sequence:CCGGTACTCTACCGCAGTGGCATTTCTCGAGAAATGCCACTGCGGTAGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000872.4-881s21c1
Sequence:CCGGTCACCTTACCTCCACTCTTTGCTCGAGCAAAGAGTGGAGGTAAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000872.4-2071s21c1
Sequence:CCGGGAATCCAGTCATCAGCTAATACTCGAGTATTAGCTGATGACTGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)