EMAIL THIS PAGE TO A FRIEND

HTRA1

HtrA serine peptidase 1

81 Gene Product Result for
Synonyms: ARMD7 CARASIL HtrA L56 ORF480 PRSS11
UniProtKB ID: Q92743, D3DRE4, Q9UNS5
Gene ID:
Human(5654) Summary: This gene encodes a member of the trypsin family of serine proteases. This protein is a secreted enzyme that is proposed to regulate the availability of insulin-like growth factors (IGFs) by cleaving IGF-binding proteins. It has also been suggested to be a regulator of cell growth. Variations in the promoter region of this gene are the cause of susceptibility to age-related macular degeneration type 7. [provided by RefSeq, Jul 2008]
Mouse(56213) HtrA serine peptidase 1
Rat(65164) HtrA serine peptidase 1
sheep(101101854) HtrA serine peptidase 1
domestic guinea pig(100716225) HtrA serine peptidase 1
naked mole-rat(101703079) HtrA serine peptidase 1
chicken(100857572) HtrA serine peptidase 1
dog(477852) HtrA serine peptidase 1
Horse(100064570) HtrA serine peptidase 1
cow(282326) HtrA serine peptidase 1
domestic cat(101095920) HtrA serine peptidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020821 MISSION® esiRNA esiRNA targeting mouse Htra1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002775 siRNAs that have been validated in the lab human pricing
NM_031721 Rosetta Predictions rat pricing
NM_019564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002775 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055643 validated 853
1 SASI_Hs01_00055644 validated 1122
1 SASI_Hs01_00055642 validated 1344
2 SASI_Hs01_00055645 predicted 1443
3 SASI_Hs02_00334407 predicted 1445
4 SASI_Hs01_00055646 predicted 1246
5 SASI_Hs01_00055647 predicted 937
6 SASI_Hs02_00334408 predicted 1121
7 SASI_Hs01_00055648 predicted 1506
8 SASI_Hs01_00055649 predicted 1267
9 SASI_Hs01_00055650 predicted 1504
10 SASI_Hs01_00055651 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110138 predicted 1366
2 SASI_Rn01_00110139 predicted 1261
3 SASI_Rn01_00110140 predicted 1239
4 SASI_Rn01_00110141 predicted 1173
5 SASI_Rn01_00110142 predicted 532
6 SASI_Rn01_00110143 predicted 862
7 SASI_Rn01_00110144 predicted 1187
8 SASI_Rn01_00110145 predicted 965
9 SASI_Rn01_00110146 predicted 781
10 SASI_Rn02_00265092 predicted 726
11 SASI_Rn01_00110147 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123252 predicted 1429
2 SASI_Mm01_00123253 predicted 1088
3 SASI_Mm01_00123254 predicted 1168
4 SASI_Mm01_00123255 predicted 740
5 SASI_Mm01_00123256 predicted 580
6 SASI_Mm01_00123257 predicted 529
7 SASI_Mm02_00324603 predicted 1185
8 SASI_Mm01_00123258 predicted 964
9 SASI_Mm01_00123259 predicted 1529
10 SASI_Mm01_00123260 predicted 1362
11 SASI_Mm01_00123261 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002775
VALIDATED
HTRA1 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-612s21c1
Sequence:CCGGCCCAACAGTTTGCGCCATAAACTCGAGTTTATGGCGCAAACTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1088s21c1
Sequence:CCGGCGCCATCATCAACTATGGAAACTCGAGTTTCCATAGTTGATGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1136s21c1
Sequence:CCGGCGGTGAAGTGATTGGAATTAACTCGAGTTAATTCCAATCACTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1056s1c1
Sequence:CCGGCGGTGAAGTGATTGGAATTAACTCGAGTTAATTCCAATCACTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1268s21c1
Sequence:CCGGGAAGTATATTGGTATCCGAATCTCGAGATTCGGATACCAATATACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-532s1c1
Sequence:CCGGCCCAACAGTTTGCGCCATAAACTCGAGTTTATGGCGCAAACTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1188s1c1
Sequence:CCGGGAAGTATATTGGTATCCGAATCTCGAGATTCGGATACCAATATACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002775.2-594s1c1
Sequence:CCGGCGTGGTTCATATCGAATTGTTCTCGAGAACAATTCGATATGAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1008s1c1
Sequence:CCGGCGCCATCATCAACTATGGAAACTCGAGTTTCCATAGTTGATGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002775
VALIDATED
HTRA1 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-612s21c1
Sequence:CCGGCCCAACAGTTTGCGCCATAAACTCGAGTTTATGGCGCAAACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1088s21c1
Sequence:CCGGCGCCATCATCAACTATGGAAACTCGAGTTTCCATAGTTGATGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1136s21c1
Sequence:CCGGCGGTGAAGTGATTGGAATTAACTCGAGTTAATTCCAATCACTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1056s1c1
Sequence:CCGGCGGTGAAGTGATTGGAATTAACTCGAGTTAATTCCAATCACTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1268s21c1
Sequence:CCGGGAAGTATATTGGTATCCGAATCTCGAGATTCGGATACCAATATACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-532s1c1
Sequence:CCGGCCCAACAGTTTGCGCCATAAACTCGAGTTTATGGCGCAAACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1188s1c1
Sequence:CCGGGAAGTATATTGGTATCCGAATCTCGAGATTCGGATACCAATATACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002775.2-594s1c1
Sequence:CCGGCGTGGTTCATATCGAATTGTTCTCGAGAACAATTCGATATGAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1008s1c1
Sequence:CCGGCGCCATCATCAACTATGGAAACTCGAGTTTCCATAGTTGATGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002775
VALIDATED
HTRA1 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-612s21c1
Sequence:CCGGCCCAACAGTTTGCGCCATAAACTCGAGTTTATGGCGCAAACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1088s21c1
Sequence:CCGGCGCCATCATCAACTATGGAAACTCGAGTTTCCATAGTTGATGATGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1136s21c1
Sequence:CCGGCGGTGAAGTGATTGGAATTAACTCGAGTTAATTCCAATCACTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1056s1c1
Sequence:CCGGCGGTGAAGTGATTGGAATTAACTCGAGTTAATTCCAATCACTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002775.4-1268s21c1
Sequence:CCGGGAAGTATATTGGTATCCGAATCTCGAGATTCGGATACCAATATACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-532s1c1
Sequence:CCGGCCCAACAGTTTGCGCCATAAACTCGAGTTTATGGCGCAAACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1188s1c1
Sequence:CCGGGAAGTATATTGGTATCCGAATCTCGAGATTCGGATACCAATATACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002775.2-594s1c1
Sequence:CCGGCGTGGTTCATATCGAATTGTTCTCGAGAACAATTCGATATGAACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002775.2-1008s1c1
Sequence:CCGGCGCCATCATCAACTATGGAAACTCGAGTTTCCATAGTTGATGATGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019564
VALIDATED
HTRA1 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-587s1c1
Sequence:CCGGCGGATGTGGTTAAACATGAATCTCGAGATTCATGTTTAACCACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019564.1-540s1c1
Sequence:CCGGGCGTCATAAGTACAACTTTATCTCGAGATAAAGTTGTACTTATGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-1005s1c1
Sequence:CCGGCGCTATCATCAATTATGGAAACTCGAGTTTCCATAATTGATGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019564.1-1100s1c1
Sequence:CCGGCCTTCGCAATTCCATCCGATACTCGAGTATCGGATGGAATTGCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-1439s1c1
Sequence:CCGGGCAATGAAGACATTGTGATTACTCGAGTAATCACAATGTCTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019564
VALIDATED
HTRA1 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-587s1c1
Sequence:CCGGCGGATGTGGTTAAACATGAATCTCGAGATTCATGTTTAACCACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019564.1-540s1c1
Sequence:CCGGGCGTCATAAGTACAACTTTATCTCGAGATAAAGTTGTACTTATGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-1005s1c1
Sequence:CCGGCGCTATCATCAATTATGGAAACTCGAGTTTCCATAATTGATGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019564.1-1100s1c1
Sequence:CCGGCCTTCGCAATTCCATCCGATACTCGAGTATCGGATGGAATTGCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-1439s1c1
Sequence:CCGGGCAATGAAGACATTGTGATTACTCGAGTAATCACAATGTCTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019564
VALIDATED
HTRA1 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-587s1c1
Sequence:CCGGCGGATGTGGTTAAACATGAATCTCGAGATTCATGTTTAACCACATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019564.1-540s1c1
Sequence:CCGGGCGTCATAAGTACAACTTTATCTCGAGATAAAGTTGTACTTATGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-1005s1c1
Sequence:CCGGCGCTATCATCAATTATGGAAACTCGAGTTTCCATAATTGATGATAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019564.1-1100s1c1
Sequence:CCGGCCTTCGCAATTCCATCCGATACTCGAGTATCGGATGGAATTGCGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019564.1-1439s1c1
Sequence:CCGGGCAATGAAGACATTGTGATTACTCGAGTAATCACAATGTCTTCATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)