EMAIL THIS PAGE TO A FRIEND

HTRA2

HtrA serine peptidase 2

107 Gene Product Result for
Synonyms: OMI PARK13 PRSS25
UniProtKB ID: O43464, Q9HBZ4, Q9P0Y3, Q9P0Y4
Gene ID:
Human(27429) Summary: This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional transcript variants have been described, but their full-length sequences have not been determined. [provided by RefSeq, Jul 2008]
Mouse(64704) HtrA serine peptidase 2
Rat(297376) HtrA serine peptidase 2
fruit fly(41756) CG8464 gene product from transcript CG8464-RB
chicken(395990) HtrA serine peptidase 2
dog(475782) HtrA serine peptidase 2
domestic cat(768259) HtrA serine peptidase 2
cow(523039) HtrA serine peptidase 2
domestic guinea pig(100734064) HtrA serine peptidase 2
naked mole-rat(101725239) HtrA serine peptidase 2
sheep(101120228) HtrA serine peptidase 2
Domestic Rabbit(100338967) HtrA serine peptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H7165 Anti-HtrA2 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat
western blot pricing
SAB1300530 Anti-HtrA2 (OMI) (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA pricing
SAB1412110 ANTI-HTRA2 antibody produced in mouse clone 6H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
H7290 Anti-HtrA2 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat
western blot pricing
HPA027366 Anti-HTRA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4501221 Anti-HTRA2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
HPA006602 Anti-HTRA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
PRS3051 Anti-OMI (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3319 Anti-OMI (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0027429M2 Monoclonal Anti-HTRA2 antibody produced in mouse clone 4F10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405043 Monoclonal Anti-HTRA2, (C-terminal) antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013247 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151841 MISSION® esiRNA esiRNA human HTRA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013247 Rosetta Predictions human pricing
NM_145074 Rosetta Predictions human pricing
NM_001106599 Rosetta Predictions rat pricing
NM_019752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010303 predicted 710
2 SASI_Hs01_00010305 predicted 1751
3 SASI_Hs01_00010306 predicted 1472
4 SASI_Hs01_00010307 predicted 1596
5 SASI_Hs01_00010308 predicted 1229
6 SASI_Hs01_00010309 predicted 1933
7 SASI_Hs01_00010310 predicted 1972
8 SASI_Hs01_00010311 predicted 1478
9 SASI_Hs01_00010312 predicted 2317
10 SASI_Hs02_00344456 predicted 1930
11 SASI_Hs01_00010304 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139862 predicted 710
2 SASI_Hs01_00139864 predicted 1297
3 SASI_Hs01_00139865 predicted 1282
4 SASI_Hs01_00139866 predicted 1223
5 SASI_Hs01_00139867 predicted 2141
6 SASI_Hs01_00139868 predicted 1683
7 SASI_Hs01_00139869 predicted 1975
8 SASI_Hs01_00139870 predicted 1636
9 SASI_Hs02_00364971 predicted 2032
10 SASI_Hs01_00139871 predicted 1404
11 SASI_Hs01_00139863 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220538 predicted 643
2 SASI_Rn02_00220539 predicted 1091
3 SASI_Rn02_00220540 predicted 1180
4 SASI_Rn02_00220541 predicted 707
5 SASI_Rn02_00220542 predicted 360
6 SASI_Rn02_00220543 predicted 695
7 SASI_Rn02_00220544 predicted 890
8 SASI_Rn02_00220545 predicted 1176
9 SASI_Rn02_00220546 predicted 1098
10 SASI_Rn02_00220547 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120505 predicted 1309
2 SASI_Mm01_00120506 predicted 368
3 SASI_Mm01_00120507 predicted 845
4 SASI_Mm01_00120508 predicted 1142
5 SASI_Mm01_00120510 predicted 279
6 SASI_Mm01_00120511 predicted 1218
7 SASI_Mm01_00120512 predicted 742
8 SASI_Mm01_00120513 predicted 1020
9 SASI_Mm01_00120514 predicted 1256
10 SASI_Mm02_00324915 predicted 822
11 SASI_Mm01_00120509 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019752
VALIDATED
HTRA2 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-1564s1c1
Sequence:CCGGCCTCCTTGCTTTCCTAGCCTACTCGAGTAGGCTAGGAAAGCAAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-581s1c1
Sequence:CCGGCAGTACAATTTCATCGCAGATCTCGAGATCTGCGATGAAATTGTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-678s1c1
Sequence:CCGGCCATCTCAAACGGATCAGGATCTCGAGATCCTGATCCGTTTGAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019752.2-1140s1c1
Sequence:CCGGCCATCCCTTCTGATCGCCTTACTCGAGTAAGGCGATCAGAAGGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019752.2-1019s1c1
Sequence:CCGGGTGGAATACATTCAGACCGATCTCGAGATCGGTCTGAATGTATTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019752.2-1564s21c1
Sequence:CCGGCCTCCTTGCTTTCCTAGCCTACTCGAGTAGGCTAGGAAAGCAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019752.2-1140s21c1
Sequence:CCGGCCATCCCTTCTGATCGCCTTACTCGAGTAAGGCGATCAGAAGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019752.2-948s21c1
Sequence:CCGGACACGATCACATCTGGTATTGCTCGAGCAATACCAGATGTGATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019752.2-832s21c1
Sequence:CCGGTGCCACACTGAGGATTCAAACCTCGAGGTTTGAATCCTCAGTGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019752
VALIDATED
HTRA2 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-1564s1c1
Sequence:CCGGCCTCCTTGCTTTCCTAGCCTACTCGAGTAGGCTAGGAAAGCAAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-581s1c1
Sequence:CCGGCAGTACAATTTCATCGCAGATCTCGAGATCTGCGATGAAATTGTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-678s1c1
Sequence:CCGGCCATCTCAAACGGATCAGGATCTCGAGATCCTGATCCGTTTGAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019752.2-1140s1c1
Sequence:CCGGCCATCCCTTCTGATCGCCTTACTCGAGTAAGGCGATCAGAAGGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019752.2-1019s1c1
Sequence:CCGGGTGGAATACATTCAGACCGATCTCGAGATCGGTCTGAATGTATTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019752.2-1564s21c1
Sequence:CCGGCCTCCTTGCTTTCCTAGCCTACTCGAGTAGGCTAGGAAAGCAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019752.2-1140s21c1
Sequence:CCGGCCATCCCTTCTGATCGCCTTACTCGAGTAAGGCGATCAGAAGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019752.2-948s21c1
Sequence:CCGGACACGATCACATCTGGTATTGCTCGAGCAATACCAGATGTGATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019752.2-832s21c1
Sequence:CCGGTGCCACACTGAGGATTCAAACCTCGAGGTTTGAATCCTCAGTGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019752
VALIDATED
HTRA2 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-1564s1c1
Sequence:CCGGCCTCCTTGCTTTCCTAGCCTACTCGAGTAGGCTAGGAAAGCAAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-581s1c1
Sequence:CCGGCAGTACAATTTCATCGCAGATCTCGAGATCTGCGATGAAATTGTACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019752.2-678s1c1
Sequence:CCGGCCATCTCAAACGGATCAGGATCTCGAGATCCTGATCCGTTTGAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019752.2-1140s1c1
Sequence:CCGGCCATCCCTTCTGATCGCCTTACTCGAGTAAGGCGATCAGAAGGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019752.2-1019s1c1
Sequence:CCGGGTGGAATACATTCAGACCGATCTCGAGATCGGTCTGAATGTATTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019752.2-1564s21c1
Sequence:CCGGCCTCCTTGCTTTCCTAGCCTACTCGAGTAGGCTAGGAAAGCAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019752.2-1140s21c1
Sequence:CCGGCCATCCCTTCTGATCGCCTTACTCGAGTAAGGCGATCAGAAGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019752.2-948s21c1
Sequence:CCGGACACGATCACATCTGGTATTGCTCGAGCAATACCAGATGTGATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019752.2-832s21c1
Sequence:CCGGTGCCACACTGAGGATTCAAACCTCGAGGTTTGAATCCTCAGTGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013247
VALIDATED
HTRA2 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013247.3-2121s1c1
Sequence:CCGGGAAGAATCACAGAAACACTTTCTCGAGAAAGTGTTTCTGTGATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1465s1c1
Sequence:CCGGCCCAAACCAATGTGGAATACACTCGAGTGTATTCCACATTGGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1466s1c1
Sequence:CCGGCCAAACCAATGTGGAATACATCTCGAGATGTATTCCACATTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1031s1c1
Sequence:CCGGCCGGAGTCAGTACAACTTCATCTCGAGATGAAGTTGTACTGACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013247.3-1725s1c1
Sequence:CCGGGCTGAACTACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1767s21c1
Sequence:CCGGCATGGTGTACTCATCCATAAACTCGAGTTTATGGATGAGTACACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1073s21c1
Sequence:CCGGAGCACCTGCCGTGGTCTATATCTCGAGATATAGACCACGGCAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1409s21c1
Sequence:CCGGGATCACATCCGGCATTGTTAGCTCGAGCTAACAATGCCGGATGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1293s21c1
Sequence:CCGGACGCTGAGGATTCAGACTAAGCTCGAGCTTAGTCTGAATCCTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013247.4-1606s21c1
Sequence:CCGGCTGATCGTCTTCGAGAGTTTCCTCGAGGAAACTCTCGAAGACGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013247
VALIDATED
HTRA2 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013247.3-2121s1c1
Sequence:CCGGGAAGAATCACAGAAACACTTTCTCGAGAAAGTGTTTCTGTGATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1465s1c1
Sequence:CCGGCCCAAACCAATGTGGAATACACTCGAGTGTATTCCACATTGGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1466s1c1
Sequence:CCGGCCAAACCAATGTGGAATACATCTCGAGATGTATTCCACATTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1031s1c1
Sequence:CCGGCCGGAGTCAGTACAACTTCATCTCGAGATGAAGTTGTACTGACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013247.3-1725s1c1
Sequence:CCGGGCTGAACTACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1767s21c1
Sequence:CCGGCATGGTGTACTCATCCATAAACTCGAGTTTATGGATGAGTACACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1073s21c1
Sequence:CCGGAGCACCTGCCGTGGTCTATATCTCGAGATATAGACCACGGCAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1409s21c1
Sequence:CCGGGATCACATCCGGCATTGTTAGCTCGAGCTAACAATGCCGGATGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1293s21c1
Sequence:CCGGACGCTGAGGATTCAGACTAAGCTCGAGCTTAGTCTGAATCCTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013247.4-1606s21c1
Sequence:CCGGCTGATCGTCTTCGAGAGTTTCCTCGAGGAAACTCTCGAAGACGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013247
VALIDATED
HTRA2 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013247.3-2121s1c1
Sequence:CCGGGAAGAATCACAGAAACACTTTCTCGAGAAAGTGTTTCTGTGATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1465s1c1
Sequence:CCGGCCCAAACCAATGTGGAATACACTCGAGTGTATTCCACATTGGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1466s1c1
Sequence:CCGGCCAAACCAATGTGGAATACATCTCGAGATGTATTCCACATTGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013247.3-1031s1c1
Sequence:CCGGCCGGAGTCAGTACAACTTCATCTCGAGATGAAGTTGTACTGACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013247.3-1725s1c1
Sequence:CCGGGCTGAACTACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1767s21c1
Sequence:CCGGCATGGTGTACTCATCCATAAACTCGAGTTTATGGATGAGTACACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1073s21c1
Sequence:CCGGAGCACCTGCCGTGGTCTATATCTCGAGATATAGACCACGGCAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1409s21c1
Sequence:CCGGGATCACATCCGGCATTGTTAGCTCGAGCTAACAATGCCGGATGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013247.4-1293s21c1
Sequence:CCGGACGCTGAGGATTCAGACTAAGCTCGAGCTTAGTCTGAATCCTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013247.4-1606s21c1
Sequence:CCGGCTGATCGTCTTCGAGAGTTTCCTCGAGGAAACTCTCGAAGACGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)