EMAIL THIS PAGE TO A FRIEND

HTRA3

HtrA serine peptidase 3

86 Gene Product Result for
Synonyms: Prsp Tasp
UniProtKB ID: P83110, Q7Z7A2
Gene ID:
Mouse(78558) HtrA serine peptidase 3
Rat(360959) HtrA serine peptidase 3
sheep(101119395) HtrA serine peptidase 3
domestic guinea pig(100716678) HtrA serine peptidase 3
naked mole-rat(101719583) HtrA serine peptidase 3
chicken(422868) HtrA serine peptidase 3
dog(100687287) HtrA serine peptidase 3
cow(100336523) HtrA serine peptidase 3
domestic cat(101089007) HtrA serine peptidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008431 MISSION® esiRNA esiRNA targeting human HTRA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053044 Rosetta Predictions human pricing
XM_001058037 Rosetta Predictions rat pricing
XM_341237 Rosetta Predictions rat pricing
NM_001042615 Rosetta Predictions mouse pricing
NM_030127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204488 predicted 1004
2 SASI_Hs01_00204489 predicted 1813
3 SASI_Hs01_00204490 predicted 1431
4 SASI_Hs01_00204491 predicted 1088
5 SASI_Hs02_00361876 predicted 667
6 SASI_Hs01_00204492 predicted 1784
7 SASI_Hs01_00204493 predicted 1204
8 SASI_Hs01_00204494 predicted 598
9 SASI_Hs01_00204495 predicted 1889
10 SASI_Hs01_00204496 predicted 841
11 SASI_Hs01_00204487 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288355 predicted 1515
2 SASI_Rn02_00288356 predicted 1585
3 SASI_Rn02_00288357 predicted 1972
4 SASI_Rn02_00288358 predicted 1168
5 SASI_Rn02_00288359 predicted 1655
6 SASI_Rn02_00288360 predicted 2038
7 SASI_Rn02_00288361 predicted 1947
8 SASI_Rn02_00288362 predicted 1130
9 SASI_Rn02_00288363 predicted 858
10 SASI_Rn02_00288364 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392623 predicted 1510
2 SASI_Rn02_00392624 predicted 1588
3 SASI_Rn02_00392625 predicted 1973
4 SASI_Rn02_00392626 predicted 1165
5 SASI_Rn02_00392627 predicted 1658
6 SASI_Rn02_00392628 predicted 2041
7 SASI_Rn02_00392629 predicted 1948
8 SASI_Rn02_00392630 predicted 1126
9 SASI_Rn02_00392631 predicted 859
10 SASI_Rn02_00392632 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290755 predicted 861
2 SASI_Mm02_00290756 predicted 1125
3 SASI_Mm02_00290757 predicted 1258
4 SASI_Mm02_00290758 predicted 722
5 SASI_Mm02_00290759 predicted 1124
6 SASI_Mm02_00290760 predicted 948
7 SASI_Mm02_00290761 predicted 844
8 SASI_Mm02_00290762 predicted 906
9 SASI_Mm02_00290763 predicted 1169
10 SASI_Mm02_00290764 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336513 predicted 856
2 SASI_Mm02_00336514 predicted 1125
3 SASI_Mm02_00336515 predicted 1254
4 SASI_Mm02_00336516 predicted 726
5 SASI_Mm01_00180728 predicted 1127
6 SASI_Mm02_00336517 predicted 950
7 SASI_Mm02_00336518 predicted 843
8 SASI_Mm02_00336519 predicted 900
9 SASI_Mm01_00180735 predicted 1163
10 SASI_Mm02_00336520 predicted 904
11 SASI_Mm01_00180729 predicted 1554
12 SASI_Mm01_00180730 predicted 1811
13 SASI_Mm01_00180731 predicted 699
14 SASI_Mm01_00180732 predicted 651
15 SASI_Mm01_00180733 predicted 1274
16 SASI_Mm01_00180734 predicted 1299
17 SASI_Mm01_00180736 predicted 1772
18 SASI_Mm01_00180737 predicted 1600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053044
VALIDATED
HTRA3 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1262s21c1
Sequence:CCGGAGAAGCGCTTCATCGGCATACCTCGAGGTATGCCGATGAAGCGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1091s21c1
Sequence:CCGGCGGATGCCATCATCAACTACGCTCGAGCGTAGTTGATGATGGCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1344s21c1
Sequence:CCGGAGAGGTCAGCAGTGGAATTTACTCGAGTAAATTCCACTGCTGACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-1803s1c1
Sequence:CCGGCCTGAAAGTCACTTCCAAGTTCTCGAGAACTTGGAAGTGACTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-613s1c1
Sequence:CCGGCGCTACAAGTTCAACTTCATTCTCGAGAATGAAGTTGAACTTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053044.2-1152s1c1
Sequence:CCGGCATTGGCATCAACACGCTCAACTCGAGTTGAGCGTGTTGATGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-894s1c1
Sequence:CCGGCATCAAGATCCATCCCAAGAACTCGAGTTCTTGGGATGGATCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-995s1c1
Sequence:CCGGCCCTACAGAACACAGTGACAACTCGAGTTGTCACTGTGTTCTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053044
VALIDATED
HTRA3 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1262s21c1
Sequence:CCGGAGAAGCGCTTCATCGGCATACCTCGAGGTATGCCGATGAAGCGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1091s21c1
Sequence:CCGGCGGATGCCATCATCAACTACGCTCGAGCGTAGTTGATGATGGCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1344s21c1
Sequence:CCGGAGAGGTCAGCAGTGGAATTTACTCGAGTAAATTCCACTGCTGACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-1803s1c1
Sequence:CCGGCCTGAAAGTCACTTCCAAGTTCTCGAGAACTTGGAAGTGACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-613s1c1
Sequence:CCGGCGCTACAAGTTCAACTTCATTCTCGAGAATGAAGTTGAACTTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053044.2-1152s1c1
Sequence:CCGGCATTGGCATCAACACGCTCAACTCGAGTTGAGCGTGTTGATGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-894s1c1
Sequence:CCGGCATCAAGATCCATCCCAAGAACTCGAGTTCTTGGGATGGATCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-995s1c1
Sequence:CCGGCCCTACAGAACACAGTGACAACTCGAGTTGTCACTGTGTTCTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053044
VALIDATED
HTRA3 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1262s21c1
Sequence:CCGGAGAAGCGCTTCATCGGCATACCTCGAGGTATGCCGATGAAGCGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1091s21c1
Sequence:CCGGCGGATGCCATCATCAACTACGCTCGAGCGTAGTTGATGATGGCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053044.2-1344s21c1
Sequence:CCGGAGAGGTCAGCAGTGGAATTTACTCGAGTAAATTCCACTGCTGACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-1803s1c1
Sequence:CCGGCCTGAAAGTCACTTCCAAGTTCTCGAGAACTTGGAAGTGACTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-613s1c1
Sequence:CCGGCGCTACAAGTTCAACTTCATTCTCGAGAATGAAGTTGAACTTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053044.2-1152s1c1
Sequence:CCGGCATTGGCATCAACACGCTCAACTCGAGTTGAGCGTGTTGATGCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-894s1c1
Sequence:CCGGCATCAAGATCCATCCCAAGAACTCGAGTTCTTGGGATGGATCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053044.2-995s1c1
Sequence:CCGGCCCTACAGAACACAGTGACAACTCGAGTTGTCACTGTGTTCTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030127
HTRA3 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1130s1c1
Sequence:CCGGCCATCATCAATTACGGGAACTCTCGAGAGTTCCCGTAATTGATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-645s1c1
Sequence:CCGGGCGGTACAAGTTCAACTTCATCTCGAGATGAAGTTGAACTTGTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1253s1c1
Sequence:CCGGGCTTCCTCTCTGAGTTCCAAACTCGAGTTTGGAACTCAGAGAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1447s1c1
Sequence:CCGGGATGGCGACATCATCGTCAAACTCGAGTTTGACGATGATGTCGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-900s1c1
Sequence:CCGGCATCGACAAGAAGTCGGACATCTCGAGATGTCCGACTTCTTGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030127
HTRA3 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1130s1c1
Sequence:CCGGCCATCATCAATTACGGGAACTCTCGAGAGTTCCCGTAATTGATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-645s1c1
Sequence:CCGGGCGGTACAAGTTCAACTTCATCTCGAGATGAAGTTGAACTTGTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1253s1c1
Sequence:CCGGGCTTCCTCTCTGAGTTCCAAACTCGAGTTTGGAACTCAGAGAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1447s1c1
Sequence:CCGGGATGGCGACATCATCGTCAAACTCGAGTTTGACGATGATGTCGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-900s1c1
Sequence:CCGGCATCGACAAGAAGTCGGACATCTCGAGATGTCCGACTTCTTGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030127
HTRA3 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1130s1c1
Sequence:CCGGCCATCATCAATTACGGGAACTCTCGAGAGTTCCCGTAATTGATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-645s1c1
Sequence:CCGGGCGGTACAAGTTCAACTTCATCTCGAGATGAAGTTGAACTTGTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1253s1c1
Sequence:CCGGGCTTCCTCTCTGAGTTCCAAACTCGAGTTTGGAACTCAGAGAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-1447s1c1
Sequence:CCGGGATGGCGACATCATCGTCAAACTCGAGTTTGACGATGATGTCGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030127.1-900s1c1
Sequence:CCGGCATCGACAAGAAGTCGGACATCTCGAGATGTCCGACTTCTTGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)