EMAIL THIS PAGE TO A FRIEND

HTRA4

HtrA serine peptidase 4

57 Gene Product Result for
UniProtKB ID: P83105, Q542Z4, Q6PF13
Gene ID:
Human(203100) Summary: This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Mouse(330723) HtrA serine peptidase 4
Rat(306564) HtrA serine peptidase 4
dog(475580) HtrA serine peptidase 4
cow(514946) HtrA serine peptidase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153692 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153692 Rosetta Predictions human pricing
NM_001107321 Rosetta Predictions rat pricing
NM_001081187 Rosetta Predictions mouse pricing
XM_284398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150179 predicted 1026
2 SASI_Hs01_00150180 predicted 1088
3 SASI_Hs01_00150181 predicted 758
4 SASI_Hs01_00150182 predicted 1184
5 SASI_Hs02_00367403 predicted 1090
6 SASI_Hs01_00150183 predicted 1015
7 SASI_Hs01_00150184 predicted 1083
8 SASI_Hs01_00150185 predicted 1279
9 SASI_Hs01_00150186 predicted 781
10 SASI_Hs01_00150187 predicted 798
11 SASI_Hs01_00150178 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227685 predicted 1205
2 SASI_Rn02_00227686 predicted 1222
3 SASI_Rn02_00227687 predicted 859
4 SASI_Rn02_00227688 predicted 1429
5 SASI_Rn02_00227689 predicted 1488
6 SASI_Rn02_00227690 predicted 915
7 SASI_Rn02_00227691 predicted 854
8 SASI_Rn02_00227692 predicted 1047
9 SASI_Rn02_00227693 predicted 933
10 SASI_Rn02_00227694 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296041 predicted 881
2 SASI_Mm02_00296042 predicted 1346
3 SASI_Mm02_00296043 predicted 686
4 SASI_Mm02_00296044 predicted 1207
5 SASI_Mm02_00296045 predicted 680
6 SASI_Mm02_00296046 predicted 981
7 SASI_Mm02_00296047 predicted 765
8 SASI_Mm02_00296048 predicted 1269
9 SASI_Mm02_00296049 predicted 402
10 SASI_Mm02_00296050 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217405 predicted 924
2 SASI_Mm01_00217406 predicted 1258
3 SASI_Mm01_00217407 predicted 979
4 SASI_Mm01_00217408 predicted 1034
5 SASI_Mm01_00217409 predicted 813
6 SASI_Mm01_00217410 predicted 875
7 SASI_Mm01_00217411 predicted 1189
8 SASI_Mm01_00217412 predicted 1027
9 SASI_Mm01_00217413 predicted 444
10 SASI_Mm01_00217414 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153692
HTRA4 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-1371s1c1
Sequence:CCGGCACGATGTAATTGTCAACATACTCGAGTATGTTGACAATTACATCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1524s21c1
Sequence:CCGGTCATACCTGAAACAATCAATTCTCGAGAATTGATTGTTTCAGGTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-1041s1c1
Sequence:CCGGGCCACAATTAACTATGGGAATCTCGAGATTCCCATAGTTAATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-835s1c1
Sequence:CCGGCGGTGATTAAGATTGAATCAACTCGAGTTGATTCAATCTTAATCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-714s1c1
Sequence:CCGGGACGGGCTCATTATTACCAATCTCGAGATTGGTAATAATGAGCCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-960s1c1
Sequence:CCGGGCAGGAATTGTCAGCACCAAACTCGAGTTTGGTGCTGACAATTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1189s21c1
Sequence:CCGCTAGGCAGTTCTTGGCAGAATACTCGAGTATTCTGCCAAGAACTGCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-835s21c1
Sequence:CCGGCAAGGATATTGACCTTAAATTCTCGAGAATTTAAGGTCAATATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1119s21c1
Sequence:CCGGGTGATGTGATTGGCGTCAATTCTCGAGAATTGACGCCAATCACATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153692
HTRA4 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-1371s1c1
Sequence:CCGGCACGATGTAATTGTCAACATACTCGAGTATGTTGACAATTACATCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1524s21c1
Sequence:CCGGTCATACCTGAAACAATCAATTCTCGAGAATTGATTGTTTCAGGTATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-1041s1c1
Sequence:CCGGGCCACAATTAACTATGGGAATCTCGAGATTCCCATAGTTAATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-835s1c1
Sequence:CCGGCGGTGATTAAGATTGAATCAACTCGAGTTGATTCAATCTTAATCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-714s1c1
Sequence:CCGGGACGGGCTCATTATTACCAATCTCGAGATTGGTAATAATGAGCCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-960s1c1
Sequence:CCGGGCAGGAATTGTCAGCACCAAACTCGAGTTTGGTGCTGACAATTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1189s21c1
Sequence:CCGCTAGGCAGTTCTTGGCAGAATACTCGAGTATTCTGCCAAGAACTGCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-835s21c1
Sequence:CCGGCAAGGATATTGACCTTAAATTCTCGAGAATTTAAGGTCAATATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1119s21c1
Sequence:CCGGGTGATGTGATTGGCGTCAATTCTCGAGAATTGACGCCAATCACATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153692
HTRA4 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-1371s1c1
Sequence:CCGGCACGATGTAATTGTCAACATACTCGAGTATGTTGACAATTACATCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1524s21c1
Sequence:CCGGTCATACCTGAAACAATCAATTCTCGAGAATTGATTGTTTCAGGTATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-1041s1c1
Sequence:CCGGGCCACAATTAACTATGGGAATCTCGAGATTCCCATAGTTAATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-835s1c1
Sequence:CCGGCGGTGATTAAGATTGAATCAACTCGAGTTGATTCAATCTTAATCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-714s1c1
Sequence:CCGGGACGGGCTCATTATTACCAATCTCGAGATTGGTAATAATGAGCCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153692.2-960s1c1
Sequence:CCGGGCAGGAATTGTCAGCACCAAACTCGAGTTTGGTGCTGACAATTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1189s21c1
Sequence:CCGCTAGGCAGTTCTTGGCAGAATACTCGAGTATTCTGCCAAGAACTGCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-835s21c1
Sequence:CCGGCAAGGATATTGACCTTAAATTCTCGAGAATTTAAGGTCAATATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153692.3-1119s21c1
Sequence:CCGGGTGATGTGATTGGCGTCAATTCTCGAGAATTGACGCCAATCACATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284398
HTRA4 MISSION shRNA Bacterial Glycerol Stock
HtrA serine peptidase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-595s1c1
Sequence:CCGGCCGGAGAAAGTACAACTTCATCTCGAGATGAAGTTGTACTTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1390s1c1
Sequence:CCGGCCATGATGTAATTGTCAGCATCTCGAGATGCTGACAATTACATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1486s1c1
Sequence:CCGGGCTTCGAGGAAGTCAAACCTTCTCGAGAAGGTTTGACTTCCTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1061s1c1
Sequence:CCGGGCCATCATTAACCATGGAAATCTCGAGATTTCCATGGTTAATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-857s1c1
Sequence:CCGGCTGATTAAGATCGAGCCAGATCTCGAGATCTGGCTCGATCTTAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284398
HTRA4 MISSION shRNA shRNA Plasmid DNA
HtrA serine peptidase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-595s1c1
Sequence:CCGGCCGGAGAAAGTACAACTTCATCTCGAGATGAAGTTGTACTTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1390s1c1
Sequence:CCGGCCATGATGTAATTGTCAGCATCTCGAGATGCTGACAATTACATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1486s1c1
Sequence:CCGGGCTTCGAGGAAGTCAAACCTTCTCGAGAAGGTTTGACTTCCTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1061s1c1
Sequence:CCGGGCCATCATTAACCATGGAAATCTCGAGATTTCCATGGTTAATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-857s1c1
Sequence:CCGGCTGATTAAGATCGAGCCAGATCTCGAGATCTGGCTCGATCTTAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284398
HTRA4 MISSION shRNA Lentiviral Transduction Particles
HtrA serine peptidase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-595s1c1
Sequence:CCGGCCGGAGAAAGTACAACTTCATCTCGAGATGAAGTTGTACTTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1390s1c1
Sequence:CCGGCCATGATGTAATTGTCAGCATCTCGAGATGCTGACAATTACATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1486s1c1
Sequence:CCGGGCTTCGAGGAAGTCAAACCTTCTCGAGAAGGTTTGACTTCCTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-1061s1c1
Sequence:CCGGGCCATCATTAACCATGGAAATCTCGAGATTTCCATGGTTAATGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284398.1-857s1c1
Sequence:CCGGCTGATTAAGATCGAGCCAGATCTCGAGATCTGGCTCGATCTTAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)