EMAIL THIS PAGE TO A FRIEND

HTT

huntingtin

90 Gene Product Result for
Synonyms: HD IT15
UniProtKB ID: P42858, Q9UQB7
Gene ID:
Human(3064) Summary: Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range in the number of trinucleotide repeats has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2008]
Mouse(15194) huntingtin
Rat(29424) huntingtin
Zebrafish(30214) huntingtin
fruit fly(43392) huntingtin
chicken(422878) huntingtin
cow(615059) huntingtin
dog(479074) huntingtin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411793 ANTI-HD antibody produced in mouse clone 3D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411855 ANTI-HD antibody produced in mouse clone 4G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411856 ANTI-HD antibody produced in mouse clone 1H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411873 ANTI-HD antibody produced in mouse clone 2A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411874 ANTI-HD antibody produced in mouse clone 1A12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411875 ANTI-HD antibody produced in mouse clone 4F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411876 ANTI-HD antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1411877 ANTI-HD antibody produced in mouse clone 1C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1411884 ANTI-HD antibody produced in mouse clone 3F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA026114 Anti-HTT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
H7415 Anti-Huntingtin (N-terminal region) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
H7540 Anti-Huntingtin (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB4504233 Anti-phospho-Huntingtin (pSer421) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
WH0003064M1 Monoclonal Anti-HD antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403910 Monoclonal Anti-HD antibody produced in mouse clone 3F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
P1874 Monoclonal Anti-Polyglutamines antibody produced in mouse ~2 mg/mL, clone 3B5H10, purified immunoglobulin, buffered aqueous solution human
immunocytochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002111 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
ABN903 Anti-Huntingtin Anti-Huntingtin, Cat. No. ABN903, is a highly specific rabbit polyclonal antibody that targets Huntington Disease Protein and has been tested for use in Immunohistochemistry (Paraffin) and Western Blotting. pricing
MAB5492 Anti-Huntingtin Antibody, a.a. 1-82 Anti-Huntingtin Antibody, a.a. 1-82 is an antibody against Huntingtin for use in ELISA, IC, IH & WB. pricing
MAB5490 Anti-Huntingtin Antibody, a.a. 115-129 Anti-Huntingtin Antibody, a.a. 115-129 detects level of Huntingtin & has been published & validated for use in ELISA, WB, IC, IH. pricing
MABN60 Anti-Huntingtin Antibody, clone 4A4.2 This Anti-Huntingtin Antibody, clone 4A4.2 is validated for use in WB, IH for the detection of Huntingtin. pricing
AB9562 Anti-Huntingtin phosphoSer 421 Antibody Detect Huntingtin using this Anti-Huntingtin Antibody, phosphoSer 421 validated for use in WB. pricing
MAB2170 Anti-Huntingtin Protein Antibody, a.a. 1247-1646, clone HU-4E6 Detect Huntingtin Protein using this Anti-Huntingtin Protein Antibody, a.a. 1247-1646, clone HU-4E6 validated for use in ELISA, IP, WB, IC, IH(P). pricing
MAB2166 Anti-Huntingtin Protein Antibody, a.a. 181-810, clone 1HU-4C8 Anti-Huntingtin Protein Antibody, a.a. 181-810, clone 1HU-4C8 is an antibody against Huntingtin Protein for use in ELISA, IC, IH(P), IP & WB. pricing
MAB2168 Anti-Huntingtin Protein Antibody, a.a. 2146-2541, clone HU-2E8 Anti-Huntingtin Protein Antibody, a.a. 2146-2541, clone HU-2E8 is an antibody against Huntingtin Protein for use in ELISA, WB, IC, IH(P). pricing
MAB5374 Anti-Huntingtin Protein Antibody, clone mEM48 Detect Huntingtin Protein using this Anti-Huntingtin Protein Antibody, clone mEM48 validated for use in IC, IH & WB. pricing
MABN821 Anti-polyQ Disease Proteins Antibody, clone 3B5H10 Anti-polyQ Disease Proteins, clone 3B5H10, Cat. No. MABN821, is a highly specific mouse monoclonal antibody, that targets disease-associated polyQ proteins and has been tested in Electron Microscopy, Immunocytochemistry, Immunohistochemistry, Inhibition study, and Western Blotting. pricing
AB10514P Anti-Serotonin Transporter Antibody This Anti-Serotonin Transporter Antibody is validated for use in WB for the detection of Serotonin Transporter. pricing
AB1594P Anti-Serotonin Transporter Antibody Anti-Serotonin Transporter Antibody is an antibody against Serotonin Transporter for use in ELISA & WB. pricing
AB1772 Anti-Serotonin Transporter Antibody This Anti-Serotonin Transporter Antibody is validated for use in IH for the detection of Serotonin Transporter. pricing
AB9726 Anti-Serotonin Transporter Antibody Anti-Serotonin Transporter Antibody is an antibody against Serotonin Transporter for use in IH, IP & WB. pricing
MAB5618 Anti-Serotonin Transporter Antibody Anti-Serotonin Transporter Antibody detects level of Serotonin Transporter & has been published & validated for use in IH. pricing
MAB1564 Anti-Serotonin Transporter Antibody, clone 17-7A4 Detect Serotonin Transporter using this Anti-Serotonin Transporter Antibody, clone 17-7A4 validated for use in IH. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002111 Rosetta Predictions human pricing
NM_024357 Rosetta Predictions rat pricing
NM_010414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241076 predicted 1218
2 SASI_Hs01_00241077 predicted 1887
3 SASI_Hs01_00241079 predicted 6438
4 SASI_Hs01_00241080 predicted 6113
5 SASI_Hs01_00241081 predicted 5466
6 SASI_Hs02_00333227 predicted 8935
7 SASI_Hs01_00241083 predicted 1396
8 SASI_Hs02_00333228 predicted 2106
9 SASI_Hs01_00241084 predicted 5271
10 SASI_Hs02_00333229 predicted 3117
11 SASI_Hs01_00241078 predicted 3874
12 SASI_Hs01_00241082 predicted 2509
13 SASI_Hs01_00241085 predicted 2617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263918 predicted 4565
2 SASI_Rn02_00263919 predicted 582
3 SASI_Rn02_00263920 predicted 8182
4 SASI_Rn02_00263921 predicted 8537
5 SASI_Rn02_00263922 predicted 4341
6 SASI_Rn02_00263923 predicted 623
7 SASI_Rn02_00263924 predicted 7077
8 SASI_Rn02_00263925 predicted 4083
9 SASI_Rn02_00263926 predicted 2642
10 SASI_Rn02_00263927 predicted 6733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180808 predicted 1175
2 SASI_Mm01_00180809 predicted 4566
3 SASI_Mm01_00180811 predicted 8542
4 SASI_Mm01_00180812 predicted 2125
5 SASI_Mm01_00180813 predicted 4303
6 SASI_Mm01_00180814 predicted 5167
7 SASI_Mm02_00318552 predicted 8191
8 SASI_Mm02_00318553 predicted 6730
9 SASI_Mm01_00180815 predicted 627
10 SASI_Mm01_00180816 predicted 3111
11 SASI_Mm01_00180810 predicted 3054
12 SASI_Mm01_00180817 predicted 7477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010414
VALIDATED
HTT MISSION shRNA Bacterial Glycerol Stock
huntingtin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-5907s21c1
Sequence:CCGGCCTCCAGTACAAGACTTTATTCTCGAGAATAAAGTCTTGTACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010414.1-9765s21c1
Sequence:CCGGGCTAGGTTGACCAGGTGTTTGCTCGAGCAAACACCTGGTCAACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-405s21c1
Sequence:CCGGGTGAATCATTGTCTAACAATACTCGAGTATTGTTAGACAATGATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-7025s1c1
Sequence:CCGGCCTCATCCATTGTGTGCGATTCTCGAGAATCGCACACAATGGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-5907s1c1
Sequence:CCGGCCTCCAGTACAAGACTTTATTCTCGAGAATAAAGTCTTGTACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010414.1-3852s1c1
Sequence:CCGGGCCAACTATAAGGTCACCTTACTCGAGTAAGGTGACCTTATAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010414.1-9139s1c1
Sequence:CCGGCCACTGTAGTTTACAAGGTTTCTCGAGAAACCTTGTAAACTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-9694s1c1
Sequence:CCGGGCAGGGAACATGCACTATGTTCTCGAGAACATAGTGCATGTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-3070s21c1
Sequence:CCGGATAGCTTACTGCCAAGTATAACTCGAGTTATACTTGGCAGTAAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-4572s21c1
Sequence:CCGGAGGGAATCAGAGGCAATTATTCTCGAGAATAATTGCCTCTGATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010414
VALIDATED
HTT MISSION shRNA shRNA Plasmid DNA
huntingtin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-5907s21c1
Sequence:CCGGCCTCCAGTACAAGACTTTATTCTCGAGAATAAAGTCTTGTACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010414.1-9765s21c1
Sequence:CCGGGCTAGGTTGACCAGGTGTTTGCTCGAGCAAACACCTGGTCAACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-405s21c1
Sequence:CCGGGTGAATCATTGTCTAACAATACTCGAGTATTGTTAGACAATGATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-7025s1c1
Sequence:CCGGCCTCATCCATTGTGTGCGATTCTCGAGAATCGCACACAATGGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-5907s1c1
Sequence:CCGGCCTCCAGTACAAGACTTTATTCTCGAGAATAAAGTCTTGTACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010414.1-3852s1c1
Sequence:CCGGGCCAACTATAAGGTCACCTTACTCGAGTAAGGTGACCTTATAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010414.1-9139s1c1
Sequence:CCGGCCACTGTAGTTTACAAGGTTTCTCGAGAAACCTTGTAAACTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-9694s1c1
Sequence:CCGGGCAGGGAACATGCACTATGTTCTCGAGAACATAGTGCATGTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-3070s21c1
Sequence:CCGGATAGCTTACTGCCAAGTATAACTCGAGTTATACTTGGCAGTAAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-4572s21c1
Sequence:CCGGAGGGAATCAGAGGCAATTATTCTCGAGAATAATTGCCTCTGATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010414
VALIDATED
HTT MISSION shRNA Lentiviral Transduction Particles
huntingtin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-5907s21c1
Sequence:CCGGCCTCCAGTACAAGACTTTATTCTCGAGAATAAAGTCTTGTACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010414.1-9765s21c1
Sequence:CCGGGCTAGGTTGACCAGGTGTTTGCTCGAGCAAACACCTGGTCAACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-405s21c1
Sequence:CCGGGTGAATCATTGTCTAACAATACTCGAGTATTGTTAGACAATGATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-7025s1c1
Sequence:CCGGCCTCATCCATTGTGTGCGATTCTCGAGAATCGCACACAATGGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-5907s1c1
Sequence:CCGGCCTCCAGTACAAGACTTTATTCTCGAGAATAAAGTCTTGTACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010414.1-3852s1c1
Sequence:CCGGGCCAACTATAAGGTCACCTTACTCGAGTAAGGTGACCTTATAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010414.1-9139s1c1
Sequence:CCGGCCACTGTAGTTTACAAGGTTTCTCGAGAAACCTTGTAAACTACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010414.1-9694s1c1
Sequence:CCGGGCAGGGAACATGCACTATGTTCTCGAGAACATAGTGCATGTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-3070s21c1
Sequence:CCGGATAGCTTACTGCCAAGTATAACTCGAGTTATACTTGGCAGTAAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010414.1-4572s21c1
Sequence:CCGGAGGGAATCAGAGGCAATTATTCTCGAGAATAATTGCCTCTGATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002111
VALIDATED
HTT MISSION shRNA Bacterial Glycerol Stock
huntingtin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-2926s21c1
Sequence:CCGGTGTTGCCGCAGCATCACTAATCTCGAGATTAGTGATGCTGCGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-4384s21c1
Sequence:CCGGCCGTGCAGATAAGAATGCTATCTCGAGATAGCATTCTTATCTGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-4515s21c1
Sequence:CCGGTGGTTCAGTTACGGGTTAATTCTCGAGAATTAACCCGTAACTGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-988s1c1
Sequence:CCGGGCACTCAAGAAGGACACAATACTCGAGTATTGTGTCCTTCTTGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002111.6-9535s21c1
Sequence:CCGGGCTGCTGACTTGTTTACGAAACTCGAGTTTCGTAAACAAGTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-7860s1c1
Sequence:CCGGCCCATCATTTATATCAGGCATCTCGAGATGCCTGATATAAATGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-2018s1c1
Sequence:CCGGGCCCTTCAACAGGCACATTTACTCGAGTAAATGTGCCTGTTGAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-9535s1c1
Sequence:CCGGGCTGCTGACTTGTTTACGAAACTCGAGTTTCGTAAACAAGTCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-4384s1c1
Sequence:CCGGCCGTGCAGATAAGAATGCTATCTCGAGATAGCATTCTTATCTGCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-988s21c1
Sequence:CCGGGCACTCAAGAAGGACACAATACTCGAGTATTGTGTCCTTCTTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002111
VALIDATED
HTT MISSION shRNA shRNA Plasmid DNA
huntingtin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-2926s21c1
Sequence:CCGGTGTTGCCGCAGCATCACTAATCTCGAGATTAGTGATGCTGCGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-4384s21c1
Sequence:CCGGCCGTGCAGATAAGAATGCTATCTCGAGATAGCATTCTTATCTGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-4515s21c1
Sequence:CCGGTGGTTCAGTTACGGGTTAATTCTCGAGAATTAACCCGTAACTGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-988s1c1
Sequence:CCGGGCACTCAAGAAGGACACAATACTCGAGTATTGTGTCCTTCTTGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002111.6-9535s21c1
Sequence:CCGGGCTGCTGACTTGTTTACGAAACTCGAGTTTCGTAAACAAGTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-7860s1c1
Sequence:CCGGCCCATCATTTATATCAGGCATCTCGAGATGCCTGATATAAATGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-2018s1c1
Sequence:CCGGGCCCTTCAACAGGCACATTTACTCGAGTAAATGTGCCTGTTGAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-9535s1c1
Sequence:CCGGGCTGCTGACTTGTTTACGAAACTCGAGTTTCGTAAACAAGTCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-4384s1c1
Sequence:CCGGCCGTGCAGATAAGAATGCTATCTCGAGATAGCATTCTTATCTGCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-988s21c1
Sequence:CCGGGCACTCAAGAAGGACACAATACTCGAGTATTGTGTCCTTCTTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002111
VALIDATED
HTT MISSION shRNA Lentiviral Transduction Particles
huntingtin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-2926s21c1
Sequence:CCGGTGTTGCCGCAGCATCACTAATCTCGAGATTAGTGATGCTGCGGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-4384s21c1
Sequence:CCGGCCGTGCAGATAAGAATGCTATCTCGAGATAGCATTCTTATCTGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-4515s21c1
Sequence:CCGGTGGTTCAGTTACGGGTTAATTCTCGAGAATTAACCCGTAACTGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-988s1c1
Sequence:CCGGGCACTCAAGAAGGACACAATACTCGAGTATTGTGTCCTTCTTGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002111.6-9535s21c1
Sequence:CCGGGCTGCTGACTTGTTTACGAAACTCGAGTTTCGTAAACAAGTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-7860s1c1
Sequence:CCGGCCCATCATTTATATCAGGCATCTCGAGATGCCTGATATAAATGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-2018s1c1
Sequence:CCGGGCCCTTCAACAGGCACATTTACTCGAGTAAATGTGCCTGTTGAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-9535s1c1
Sequence:CCGGGCTGCTGACTTGTTTACGAAACTCGAGTTTCGTAAACAAGTCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002111.4-4384s1c1
Sequence:CCGGCCGTGCAGATAAGAATGCTATCTCGAGATAGCATTCTTATCTGCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002111.6-988s21c1
Sequence:CCGGGCACTCAAGAAGGACACAATACTCGAGTATTGTGTCCTTCTTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)