EMAIL THIS PAGE TO A FRIEND

HUS1

HUS1 checkpoint homolog (S. pombe)

77 Gene Product Result for
Synonyms: hHUS1
UniProtKB ID: O60921
Gene ID:
Human(3364) Summary: The protein encoded by this gene is a component of an evolutionarily conserved, genotoxin-activated checkpoint complex that is involved in the cell cycle arrest in response to DNA damage. This protein forms a heterotrimeric complex with checkpoint proteins RAD9 and RAD1. In response to DNA damage, the trimeric complex interacts with another protein complex consisting of checkpoint protein RAD17 and four small subunits of the replication factor C (RFC), which loads the combined complex onto the chromatin. The DNA damage induced chromatin binding has been shown to depend on the activation of the checkpoint kinase ATM, and is thought to be an early checkpoint signaling event. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Mouse(15574) Hus1 homolog (S. pombe)
Rat(498411) HUS1 checkpoint homolog (S. pombe)
chicken(428471) HUS1 checkpoint homolog (S. pombe)
dog(606789) HUS1 checkpoint homolog (S. pombe)
domestic cat(101081456) HUS1 checkpoint homolog (S. pombe)
cow(514142) HUS1 checkpoint homolog (S. pombe)
Horse(100066083) HUS1 checkpoint homolog (S. pombe)
domestic guinea pig(100713541) HUS1 checkpoint homolog (S. pombe)
naked mole-rat(101704977) HUS1 checkpoint homolog (S. pombe)
sheep(101113059) HUS1 checkpoint homolog (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004507 Rosetta Predictions human pricing
NM_001109092 Rosetta Predictions rat pricing
NM_008316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095298 predicted 652
2 SASI_Hs01_00095299 predicted 809
3 SASI_Hs01_00095300 predicted 236
4 SASI_Hs01_00095301 predicted 878
5 SASI_Hs01_00095303 predicted 723
6 SASI_Hs01_00095304 predicted 308
7 SASI_Hs01_00095305 predicted 870
8 SASI_Hs02_00337776 predicted 393
9 SASI_Hs01_00095306 predicted 247
10 SASI_Hs01_00095307 predicted 477
11 SASI_Hs01_00095302 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245050 predicted 605
2 SASI_Rn02_00245051 predicted 683
3 SASI_Rn02_00245052 predicted 451
4 SASI_Rn02_00245053 predicted 407
5 SASI_Rn02_00245054 predicted 537
6 SASI_Rn02_00245055 predicted 670
7 SASI_Rn02_00245056 predicted 311
8 SASI_Rn02_00245057 predicted 658
9 SASI_Rn02_00245058 predicted 600
10 SASI_Rn02_00245059 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187672 predicted 668
2 SASI_Mm01_00187673 predicted 609
3 SASI_Mm01_00187675 predicted 711
4 SASI_Mm01_00187676 predicted 554
5 SASI_Mm02_00313630 predicted 561
6 SASI_Mm02_00313631 predicted 482
7 SASI_Mm01_00187677 predicted 431
8 SASI_Mm01_00187678 predicted 1329
9 SASI_Mm01_00187679 predicted 248
10 SASI_Mm01_00187680 predicted 403
11 SASI_Mm01_00187674 predicted 578
12 SASI_Mm01_00187681 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004507
HUS1 MISSION shRNA Bacterial Glycerol Stock
HUS1 checkpoint homolog (S. pombe)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-779s21c1
Sequence:CCGGAGCACCCATGAGGACAGAAACCTCGAGGTTTCTGTCCTCATGGGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-724s21c1
Sequence:CCGGAGTATGTGTTACAACTCATTTCTCGAGAAATGAGTTGTAACACATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-476s21c1
Sequence:CCGGTCCGTGGAGCTGTTATCTATGCTCGAGCATAGATAACAGCTCCACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004507.2-1091s21c1
Sequence:CCGGATTTGTCCCTCTCTAACATTTCTCGAGAAATGTTAGAGAGGGACAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004507.2-1372s21c1
Sequence:CCGGGCGCACAGTCAGTCTTGCATTCTCGAGAATGCAAGACTGACTGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-258s21c1
Sequence:CCGGTTTGTGACAAGCTGGCTAATGCTCGAGCATTAGCCAGCTTGTCACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-881s1c1
Sequence:CCGGGCCTTATGCAATATTGTGAATCTCGAGATTCACAATATTGCATAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-664s1c1
Sequence:CCGGTCACCTTGTTATTGAAGCAAACTCGAGTTTGCTTCAATAACAAGGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-937s1c1
Sequence:CCGGCGTGTCCCTTCAGTATTTCATCTCGAGATGAAATACTGAAGGGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-172s1c1
Sequence:CCGGCCACTTCACACGAATCAGTAACTCGAGTTACTGATTCGTGTGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004507
HUS1 MISSION shRNA shRNA Plasmid DNA
HUS1 checkpoint homolog (S. pombe)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-779s21c1
Sequence:CCGGAGCACCCATGAGGACAGAAACCTCGAGGTTTCTGTCCTCATGGGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-724s21c1
Sequence:CCGGAGTATGTGTTACAACTCATTTCTCGAGAAATGAGTTGTAACACATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-476s21c1
Sequence:CCGGTCCGTGGAGCTGTTATCTATGCTCGAGCATAGATAACAGCTCCACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004507.2-1091s21c1
Sequence:CCGGATTTGTCCCTCTCTAACATTTCTCGAGAAATGTTAGAGAGGGACAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004507.2-1372s21c1
Sequence:CCGGGCGCACAGTCAGTCTTGCATTCTCGAGAATGCAAGACTGACTGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-258s21c1
Sequence:CCGGTTTGTGACAAGCTGGCTAATGCTCGAGCATTAGCCAGCTTGTCACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-881s1c1
Sequence:CCGGGCCTTATGCAATATTGTGAATCTCGAGATTCACAATATTGCATAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-664s1c1
Sequence:CCGGTCACCTTGTTATTGAAGCAAACTCGAGTTTGCTTCAATAACAAGGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-937s1c1
Sequence:CCGGCGTGTCCCTTCAGTATTTCATCTCGAGATGAAATACTGAAGGGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-172s1c1
Sequence:CCGGCCACTTCACACGAATCAGTAACTCGAGTTACTGATTCGTGTGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004507
HUS1 MISSION shRNA Lentiviral Transduction Particles
HUS1 checkpoint homolog (S. pombe)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-779s21c1
Sequence:CCGGAGCACCCATGAGGACAGAAACCTCGAGGTTTCTGTCCTCATGGGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-724s21c1
Sequence:CCGGAGTATGTGTTACAACTCATTTCTCGAGAAATGAGTTGTAACACATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-476s21c1
Sequence:CCGGTCCGTGGAGCTGTTATCTATGCTCGAGCATAGATAACAGCTCCACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004507.2-1091s21c1
Sequence:CCGGATTTGTCCCTCTCTAACATTTCTCGAGAAATGTTAGAGAGGGACAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004507.2-1372s21c1
Sequence:CCGGGCGCACAGTCAGTCTTGCATTCTCGAGAATGCAAGACTGACTGTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004507.2-258s21c1
Sequence:CCGGTTTGTGACAAGCTGGCTAATGCTCGAGCATTAGCCAGCTTGTCACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-881s1c1
Sequence:CCGGGCCTTATGCAATATTGTGAATCTCGAGATTCACAATATTGCATAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-664s1c1
Sequence:CCGGTCACCTTGTTATTGAAGCAAACTCGAGTTTGCTTCAATAACAAGGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-937s1c1
Sequence:CCGGCGTGTCCCTTCAGTATTTCATCTCGAGATGAAATACTGAAGGGACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004507.2-172s1c1
Sequence:CCGGCCACTTCACACGAATCAGTAACTCGAGTTACTGATTCGTGTGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008316
VALIDATED
HUS1 MISSION shRNA Bacterial Glycerol Stock
HUS1 checkpoint homolog (S. pombe)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008316.4-1338s21c1
Sequence:CCGGAGAGTTTAGCATGCTCATTTCCTCGAGGAAATGAGCATGCTAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-834s21c1
Sequence:CCGGAGACGTCTCCCTTCAGTATTTCTCGAGAAATACTGAAGGGAGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-77s21c1
Sequence:CCGGCACGAGTCAGTAACATGATAGCTCGAGCTATCATGTTACTGACTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-484s21c1
Sequence:CCGGCCAGACTGTGACGTCAGTATTCTCGAGAATACTGACGTCACAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008316.4-1038s21c1
Sequence:CCGGACTCCTTCAAATTACTCAATACTCGAGTATTGAGTAATTTGAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008316.2-672s1c1
Sequence:CCGGCCTCTGACAGTGTCTCTCAAACTCGAGTTTGAGAGACACTGTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-581s1c1
Sequence:CCGGGCCAACCTAAAGGGAGAATTACTCGAGTAATTCTCCCTTTAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-432s1c1
Sequence:CCGGCCATAAAGGTTCTTCCGAGAACTCGAGTTCTCGGAAGAACCTTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-55s1c1
Sequence:CCGGCCTGGCTTGTCTGAATCATTTCTCGAGAAATGATTCAGACAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008316.2-485s1c1
Sequence:CCGGCCAGACTGTGATGTCAGTATTCTCGAGAATACTGACATCACAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008316
VALIDATED
HUS1 MISSION shRNA shRNA Plasmid DNA
HUS1 checkpoint homolog (S. pombe)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008316.4-1338s21c1
Sequence:CCGGAGAGTTTAGCATGCTCATTTCCTCGAGGAAATGAGCATGCTAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-834s21c1
Sequence:CCGGAGACGTCTCCCTTCAGTATTTCTCGAGAAATACTGAAGGGAGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-77s21c1
Sequence:CCGGCACGAGTCAGTAACATGATAGCTCGAGCTATCATGTTACTGACTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-484s21c1
Sequence:CCGGCCAGACTGTGACGTCAGTATTCTCGAGAATACTGACGTCACAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008316.4-1038s21c1
Sequence:CCGGACTCCTTCAAATTACTCAATACTCGAGTATTGAGTAATTTGAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008316.2-672s1c1
Sequence:CCGGCCTCTGACAGTGTCTCTCAAACTCGAGTTTGAGAGACACTGTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-581s1c1
Sequence:CCGGGCCAACCTAAAGGGAGAATTACTCGAGTAATTCTCCCTTTAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-432s1c1
Sequence:CCGGCCATAAAGGTTCTTCCGAGAACTCGAGTTCTCGGAAGAACCTTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-55s1c1
Sequence:CCGGCCTGGCTTGTCTGAATCATTTCTCGAGAAATGATTCAGACAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008316.2-485s1c1
Sequence:CCGGCCAGACTGTGATGTCAGTATTCTCGAGAATACTGACATCACAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008316
VALIDATED
HUS1 MISSION shRNA Lentiviral Transduction Particles
HUS1 checkpoint homolog (S. pombe)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008316.4-1338s21c1
Sequence:CCGGAGAGTTTAGCATGCTCATTTCCTCGAGGAAATGAGCATGCTAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-834s21c1
Sequence:CCGGAGACGTCTCCCTTCAGTATTTCTCGAGAAATACTGAAGGGAGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-77s21c1
Sequence:CCGGCACGAGTCAGTAACATGATAGCTCGAGCTATCATGTTACTGACTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008316.4-484s21c1
Sequence:CCGGCCAGACTGTGACGTCAGTATTCTCGAGAATACTGACGTCACAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008316.4-1038s21c1
Sequence:CCGGACTCCTTCAAATTACTCAATACTCGAGTATTGAGTAATTTGAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008316.2-672s1c1
Sequence:CCGGCCTCTGACAGTGTCTCTCAAACTCGAGTTTGAGAGACACTGTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-581s1c1
Sequence:CCGGGCCAACCTAAAGGGAGAATTACTCGAGTAATTCTCCCTTTAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-432s1c1
Sequence:CCGGCCATAAAGGTTCTTCCGAGAACTCGAGTTCTCGGAAGAACCTTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008316.2-55s1c1
Sequence:CCGGCCTGGCTTGTCTGAATCATTTCTCGAGAAATGATTCAGACAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008316.2-485s1c1
Sequence:CCGGCCAGACTGTGATGTCAGTATTCTCGAGAATACTGACATCACAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)