EMAIL THIS PAGE TO A FRIEND

HUS1B

HUS1 checkpoint homolog b (S. pombe)

48 Gene Product Result for
Synonyms: RP11-532F6.1
UniProtKB ID: Q8NHY5, Q5T4Z2
Gene ID:
Human(135458) Summary: The protein encoded by this gene is most closely related to HUS1, a component of a cell cycle checkpoint protein complex involved in cell cycle arrest in response to DNA damage. This protein can interact with the check point protein RAD1 but not with RAD9. Overexpression of this protein has been shown to induce cell death, which suggests a related but distinct role of this protein, as compared to the HUS1. [provided by RefSeq, Jul 2008]
Mouse(210554) Hus1 homolog b (S. pombe)
Rat(691382) HUS1 checkpoint homolog b (S. pombe)
domestic cat(101090690) HUS1 checkpoint homolog b (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU049121 MISSION® esiRNA esiRNA targeting mouse Hus1b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148959 Rosetta Predictions human pricing
NM_001134846 Rosetta Predictions rat pricing
NM_153072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142064 predicted 579
2 SASI_Hs01_00142065 predicted 599
3 SASI_Hs01_00142066 predicted 214
4 SASI_Hs01_00142067 predicted 229
5 SASI_Hs01_00142068 predicted 577
6 SASI_Hs01_00142069 predicted 416
7 SASI_Hs01_00142070 predicted 300
8 SASI_Hs01_00142071 predicted 603
9 SASI_Hs01_00142072 predicted 387
10 SASI_Hs01_00142073 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258724 predicted 320
2 SASI_Rn02_00258725 predicted 204
3 SASI_Rn02_00258726 predicted 465
4 SASI_Rn02_00258727 predicted 369
5 SASI_Rn02_00258728 predicted 324
6 SASI_Rn02_00258729 predicted 382
7 SASI_Rn02_00258730 predicted 446
8 SASI_Rn02_00258731 predicted 483
9 SASI_Rn02_00258732 predicted 219
10 SASI_Rn02_00258733 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084535 predicted 316
2 SASI_Mm01_00084536 predicted 222
3 SASI_Mm01_00084537 predicted 549
4 SASI_Mm01_00084538 predicted 368
5 SASI_Mm02_00342897 predicted 477
6 SASI_Mm01_00084539 predicted 221
7 SASI_Mm01_00084540 predicted 257
8 SASI_Mm01_00084541 predicted 540
9 SASI_Mm01_00084542 predicted 555
10 SASI_Mm01_00084544 predicted 535
11 SASI_Mm01_00084543 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148959
HUS1B MISSION shRNA Bacterial Glycerol Stock
HUS1 checkpoint homolog b (S. pombe)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-750s1c1
Sequence:CCGGCCTGTGCAATATTTGGGACAACTCGAGTTGTCCCAAATATTGCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-725s1c1
Sequence:CCGGGACAGCAAATACATCCTACGACTCGAGTCGTAGGATGTATTTGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-589s1c1
Sequence:CCGGGTGGTGTCCATTCAAAGTTATCTCGAGATAACTTTGAATGGACACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-793s1c1
Sequence:CCGGGTTCAAGAAGATGTCTCTCTTCTCGAGAAGAGAGACATCTTCTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-766s1c1
Sequence:CCGGGACAATACTCTTCTTCAGCTTCTCGAGAAGCTGAAGAAGAGTATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-816s1c1
Sequence:CCGGGTATTTCATTCCTGCCTTGTACTCGAGTACAAGGCAGGAATGAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-799s1c1
Sequence:CCGGGAAGATGTCTCTCTTCAGTATCTCGAGATACTGAAGAGAGACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-696s1c1
Sequence:CCGGCAATCGGAAGCTTCTGCAGTTCTCGAGAACTGCAGAAGCTTCCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-749s1c1
Sequence:CCGGCCCTGTGCAATATTTGGGACACTCGAGTGTCCCAAATATTGCACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-721s1c1
Sequence:CCGGGAGGGACAGCAAATACATCCTCTCGAGAGGATGTATTTGCTGTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-32s1c1
Sequence:CCGGGCTGTCTAGAGCTGTTCATTCCTCGAGGAATGAACAGCTCTAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148959
HUS1B MISSION shRNA shRNA Plasmid DNA
HUS1 checkpoint homolog b (S. pombe)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-750s1c1
Sequence:CCGGCCTGTGCAATATTTGGGACAACTCGAGTTGTCCCAAATATTGCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-725s1c1
Sequence:CCGGGACAGCAAATACATCCTACGACTCGAGTCGTAGGATGTATTTGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-589s1c1
Sequence:CCGGGTGGTGTCCATTCAAAGTTATCTCGAGATAACTTTGAATGGACACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-793s1c1
Sequence:CCGGGTTCAAGAAGATGTCTCTCTTCTCGAGAAGAGAGACATCTTCTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-766s1c1
Sequence:CCGGGACAATACTCTTCTTCAGCTTCTCGAGAAGCTGAAGAAGAGTATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-816s1c1
Sequence:CCGGGTATTTCATTCCTGCCTTGTACTCGAGTACAAGGCAGGAATGAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-799s1c1
Sequence:CCGGGAAGATGTCTCTCTTCAGTATCTCGAGATACTGAAGAGAGACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-696s1c1
Sequence:CCGGCAATCGGAAGCTTCTGCAGTTCTCGAGAACTGCAGAAGCTTCCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-749s1c1
Sequence:CCGGCCCTGTGCAATATTTGGGACACTCGAGTGTCCCAAATATTGCACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-721s1c1
Sequence:CCGGGAGGGACAGCAAATACATCCTCTCGAGAGGATGTATTTGCTGTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-32s1c1
Sequence:CCGGGCTGTCTAGAGCTGTTCATTCCTCGAGGAATGAACAGCTCTAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148959
HUS1B MISSION shRNA Lentiviral Transduction Particles
HUS1 checkpoint homolog b (S. pombe)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-750s1c1
Sequence:CCGGCCTGTGCAATATTTGGGACAACTCGAGTTGTCCCAAATATTGCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-725s1c1
Sequence:CCGGGACAGCAAATACATCCTACGACTCGAGTCGTAGGATGTATTTGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-589s1c1
Sequence:CCGGGTGGTGTCCATTCAAAGTTATCTCGAGATAACTTTGAATGGACACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-793s1c1
Sequence:CCGGGTTCAAGAAGATGTCTCTCTTCTCGAGAAGAGAGACATCTTCTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-766s1c1
Sequence:CCGGGACAATACTCTTCTTCAGCTTCTCGAGAAGCTGAAGAAGAGTATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-816s1c1
Sequence:CCGGGTATTTCATTCCTGCCTTGTACTCGAGTACAAGGCAGGAATGAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-799s1c1
Sequence:CCGGGAAGATGTCTCTCTTCAGTATCTCGAGATACTGAAGAGAGACATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-696s1c1
Sequence:CCGGCAATCGGAAGCTTCTGCAGTTCTCGAGAACTGCAGAAGCTTCCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148959.2-749s1c1
Sequence:CCGGCCCTGTGCAATATTTGGGACACTCGAGTGTCCCAAATATTGCACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-721s1c1
Sequence:CCGGGAGGGACAGCAAATACATCCTCTCGAGAGGATGTATTTGCTGTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148959.2-32s1c1
Sequence:CCGGGCTGTCTAGAGCTGTTCATTCCTCGAGGAATGAACAGCTCTAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153072
HUS1B MISSION shRNA Bacterial Glycerol Stock
HUS1 checkpoint homolog b (S. pombe)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-631s1c1
Sequence:CCGGGCCGTTCTGTGTATGTCTCAACTCGAGTTGAGACATACACAGAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-573s1c1
Sequence:CCGGAGAAACTGATAGAGTGACTATCTCGAGATAGTCACTCTATCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-402s1c1
Sequence:CCGGGCTTCCCAGAAGGCGATGGAACTCGAGTTCCATCGCCTTCTGGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-232s1c1
Sequence:CCGGCTTGAGCTGATGTCTGAGCATCTCGAGATGCTCAGACATCAGCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-171s1c1
Sequence:CCGGGCGCGATGTCTTCCACCACTTCTCGAGAAGTGGTGGAAGACATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153072
HUS1B MISSION shRNA shRNA Plasmid DNA
HUS1 checkpoint homolog b (S. pombe)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-631s1c1
Sequence:CCGGGCCGTTCTGTGTATGTCTCAACTCGAGTTGAGACATACACAGAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-573s1c1
Sequence:CCGGAGAAACTGATAGAGTGACTATCTCGAGATAGTCACTCTATCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-402s1c1
Sequence:CCGGGCTTCCCAGAAGGCGATGGAACTCGAGTTCCATCGCCTTCTGGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-232s1c1
Sequence:CCGGCTTGAGCTGATGTCTGAGCATCTCGAGATGCTCAGACATCAGCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-171s1c1
Sequence:CCGGGCGCGATGTCTTCCACCACTTCTCGAGAAGTGGTGGAAGACATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153072
HUS1B MISSION shRNA Lentiviral Transduction Particles
HUS1 checkpoint homolog b (S. pombe)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-631s1c1
Sequence:CCGGGCCGTTCTGTGTATGTCTCAACTCGAGTTGAGACATACACAGAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-573s1c1
Sequence:CCGGAGAAACTGATAGAGTGACTATCTCGAGATAGTCACTCTATCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-402s1c1
Sequence:CCGGGCTTCCCAGAAGGCGATGGAACTCGAGTTCCATCGCCTTCTGGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-232s1c1
Sequence:CCGGCTTGAGCTGATGTCTGAGCATCTCGAGATGCTCAGACATCAGCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153072.1-171s1c1
Sequence:CCGGGCGCGATGTCTTCCACCACTTCTCGAGAAGTGGTGGAAGACATCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)