EMAIL THIS PAGE TO A FRIEND

HUWE1

HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase

137 Gene Product Result for
Synonyms: ARF-BP1 HECTH9 HSPC272 Ib772 LASU1 MULE URE-B1 UREB1
Gene ID:
Human(10075) Summary: This gene encodes a member of the HECT E3 ubiquitin ligase family. The HECT domain lies in the C-terminus and contains the active-site cysteine which forms an intermediate ubiquitin-thioester bond. E3 family members are divided into three subfamilies based on their protein-protein interaction domains; this gene encodes a member of the SI(ngle)-HECT E3 subfamily. In lung, breast, and colorectal carcinomas, this gene is highly expressed. Mutations in this gene has been found in 3 unrelated families with X-linked syndromic mental retardation, Turner type. [provided by RefSeq, Nov 2009]
Mouse(59026) HECT, UBA and WWE domain containing 1
Rat(501546) HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Zebrafish(559439) HECT, UBA and WWE domain containing 1
cow(511826) HECT, UBA and WWE domain containing 1
Horse(100060375) HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
domestic cat(101091091) HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
dog(480931) HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
domestic guinea pig(100722589) HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
naked mole-rat(101713610) HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
sheep(101119368) HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500179 Anti-ARF-BP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
HPA002548 Anti-HUWE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2900746 Anti-HUWE1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
PLA0293 Goat anti-Lasu1/Ureb1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. pig, chimpanzee, rabbit, horse, gorilla, dog, rhesus monkey, human, primate, marmoset
proximity ligation assay, western blot pricing
PLA0111 Rabbit anti-Lasu1/Ureb1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gibbon, human, gorilla, mouse, chimpanzee, primate
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_136108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031407 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067731 MISSION® esiRNA esiRNA human HUWE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031407 Rosetta Predictions human pricing
XM_576948 Rosetta Predictions rat pricing
XR_005443 Rosetta Predictions rat pricing
XR_009642 Rosetta Predictions rat pricing
XR_009643 Rosetta Predictions rat pricing
XR_009644 Rosetta Predictions rat pricing
NM_021523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358777 predicted 647
2 SASI_Hs01_00101505 predicted 12727
3 SASI_Hs02_00358778 predicted 1025
4 SASI_Hs01_00101507 predicted 4986
5 SASI_Hs02_00358779 predicted 583
6 SASI_Hs01_00101509 predicted 12367
7 SASI_Hs01_00101510 predicted 11259
8 SASI_Hs01_00101511 predicted 3304
9 SASI_Hs02_00358780 predicted 2416
10 SASI_Hs01_00101514 predicted 1243
11 SASI_Hs01_00101506 predicted 991
12 SASI_Hs01_00101508 predicted 1230
13 SASI_Hs01_00101512 predicted 6852
14 SASI_Hs01_00101513 predicted 12606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150848 predicted 4602
2 SASI_Rn01_00150849 predicted 11862
3 SASI_Rn01_00150850 predicted 1320
4 SASI_Rn01_00150851 predicted 588
5 SASI_Rn01_00150852 predicted 12080
6 SASI_Rn01_00150853 predicted 794
7 SASI_Rn01_00150854 predicted 4111
8 SASI_Rn01_00150855 predicted 5444
9 SASI_Rn01_00150856 predicted 4050
10 SASI_Rn01_00150857 predicted 4914
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409256 predicted 5585
2 SASI_Rn02_00409257 predicted 13024
3 SASI_Rn02_00409258 predicted 1818
4 SASI_Rn02_00409259 predicted 1099
5 SASI_Rn02_00409260 predicted 5820
6 SASI_Rn02_00409261 predicted 4871
7 SASI_Rn02_00409262 predicted 6678
8 SASI_Rn02_00409263 predicted 4813
9 SASI_Rn02_00409264 predicted 5854
10 SASI_Rn02_00409265 predicted 6140
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420585 predicted 5576
2 SASI_Rn02_00420586 predicted 13005
3 SASI_Rn02_00420587 predicted 1098
4 SASI_Rn02_00420588 predicted 1819
5 SASI_Rn02_00420589 predicted 1294
6 SASI_Rn02_00420590 predicted 4871
7 SASI_Rn02_00420591 predicted 6662
8 SASI_Rn02_00420592 predicted 4813
9 SASI_Rn02_00420593 predicted 6120
10 SASI_Rn02_00420594 predicted 6695
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420595 predicted 5645
2 SASI_Rn02_00420596 predicted 13082
3 SASI_Rn02_00420597 predicted 1166
4 SASI_Rn02_00420598 predicted 1894
5 SASI_Rn02_00420599 predicted 1365
6 SASI_Rn02_00420600 predicted 4940
7 SASI_Rn02_00420601 predicted 6727
8 SASI_Rn02_00420602 predicted 4884
9 SASI_Rn02_00420603 predicted 6187
10 SASI_Rn02_00420604 predicted 6759
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420605 predicted 5568
2 SASI_Rn02_00420606 predicted 12997
3 SASI_Rn02_00420607 predicted 1082
4 SASI_Rn02_00420608 predicted 1816
5 SASI_Rn02_00420609 predicted 1288
6 SASI_Rn02_00420610 predicted 4860
7 SASI_Rn02_00420611 predicted 6650
8 SASI_Rn02_00420612 predicted 4810
9 SASI_Rn02_00420613 predicted 6107
10 SASI_Rn02_00420614 predicted 6688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100375 predicted 852
2 SASI_Mm01_00100376 predicted 12783
3 SASI_Mm01_00100377 predicted 1818
4 SASI_Mm01_00100379 predicted 5845
5 SASI_Mm02_00326251 predicted 10232
6 SASI_Mm02_00326252 predicted 8871
7 SASI_Mm02_00326253 predicted 9646
8 SASI_Mm01_00100382 predicted 12872
9 SASI_Mm01_00100383 predicted 13196
10 SASI_Mm02_00326254 predicted 6112
11 SASI_Mm01_00100374 predicted 1054
12 SASI_Mm01_00100378 predicted 2672
13 SASI_Mm01_00100380 predicted 1259
14 SASI_Mm01_00100381 predicted 2973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136108
VALIDATED
HUWE1 MISSION shRNA Bacterial Glycerol Stock
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136108.4-13573s1c1
Sequence:CCGGGCACTCTTCATAACTCACTTTCTCGAGAAAGTGAGTTATGAAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-11841s1c1
Sequence:CCGGCCGCACTGTGTTAAACCAGATCTCGAGATCTGGTTTAACACAGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-5307s1c1
Sequence:CCGGCCACAAATATGCCATGATGTTCTCGAGAACATCATGGCATATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136108.4-10577s1c1
Sequence:CCGGCCACTACTGTTTCAACTTCTACTCGAGTAGAAGTTGAAACAGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-2029s1c1
Sequence:CCGGGCACTGCTCATCAAAGATGTTCTCGAGAACATCTTTGATGAGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136108
VALIDATED
HUWE1 MISSION shRNA shRNA Plasmid DNA
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136108.4-13573s1c1
Sequence:CCGGGCACTCTTCATAACTCACTTTCTCGAGAAAGTGAGTTATGAAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-11841s1c1
Sequence:CCGGCCGCACTGTGTTAAACCAGATCTCGAGATCTGGTTTAACACAGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-5307s1c1
Sequence:CCGGCCACAAATATGCCATGATGTTCTCGAGAACATCATGGCATATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136108.4-10577s1c1
Sequence:CCGGCCACTACTGTTTCAACTTCTACTCGAGTAGAAGTTGAAACAGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-2029s1c1
Sequence:CCGGGCACTGCTCATCAAAGATGTTCTCGAGAACATCTTTGATGAGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136108
VALIDATED
HUWE1 MISSION shRNA Lentiviral Transduction Particles
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136108.4-13573s1c1
Sequence:CCGGGCACTCTTCATAACTCACTTTCTCGAGAAAGTGAGTTATGAAGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-11841s1c1
Sequence:CCGGCCGCACTGTGTTAAACCAGATCTCGAGATCTGGTTTAACACAGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-5307s1c1
Sequence:CCGGCCACAAATATGCCATGATGTTCTCGAGAACATCATGGCATATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136108.4-10577s1c1
Sequence:CCGGCCACTACTGTTTCAACTTCTACTCGAGTAGAAGTTGAAACAGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136108.4-2029s1c1
Sequence:CCGGGCACTGCTCATCAAAGATGTTCTCGAGAACATCTTTGATGAGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031407
VALIDATED
HUWE1 MISSION shRNA Bacterial Glycerol Stock
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073306    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-6230s1c1
Sequence:CCGGCGACGAGAACTAGCACAGAATCTCGAGATTCTGTGCTAGTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073304    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-1411s1c1
Sequence:CCGGCCACACTTTCACAGATACTATCTCGAGATAGTATCTGTGAAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073303    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-10700s1c1
Sequence:CCGGGCGTCTGTGTTGTGGAGGTTTCTCGAGAAACCTCCACAACACAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073307    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_031407.2-6916s1c1
Sequence:CCGGGCTACACAAGATGGAGTCAAACTCGAGTTTGACTCCATCTTGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073305    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-5585s1c1
Sequence:CCGGGCTCCCACTATAACCTCACTTCTCGAGAAGTGAGGTTATAGTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-12382s21c1
Sequence:CCGGTTTGATGTCAAGCGCAAATATCTCGAGATATTTGCGCTTGACATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031407.4-13965s21c1
Sequence:CCGGTGCACAGCTAATGATTCAATGCTCGAGCATTGAATCATTAGCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-9529s21c1
Sequence:CCGGCGACGAGAACTAGCACAGAATCTCGAGATTCTGTGCTAGTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-10281s21c1
Sequence:CCGGCCTAGGCTGCAGGACTAATATCTCGAGATATTAGTCCTGCAGCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-879s21c1
Sequence:CCGGGCTAACTCGGCTACAACATTTCTCGAGAAATGTTGTAGCCGAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031407
VALIDATED
HUWE1 MISSION shRNA shRNA Plasmid DNA
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073306    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-6230s1c1
Sequence:CCGGCGACGAGAACTAGCACAGAATCTCGAGATTCTGTGCTAGTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073304    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-1411s1c1
Sequence:CCGGCCACACTTTCACAGATACTATCTCGAGATAGTATCTGTGAAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073303    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-10700s1c1
Sequence:CCGGGCGTCTGTGTTGTGGAGGTTTCTCGAGAAACCTCCACAACACAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073307    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_031407.2-6916s1c1
Sequence:CCGGGCTACACAAGATGGAGTCAAACTCGAGTTTGACTCCATCTTGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073305    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-5585s1c1
Sequence:CCGGGCTCCCACTATAACCTCACTTCTCGAGAAGTGAGGTTATAGTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-12382s21c1
Sequence:CCGGTTTGATGTCAAGCGCAAATATCTCGAGATATTTGCGCTTGACATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031407.4-13965s21c1
Sequence:CCGGTGCACAGCTAATGATTCAATGCTCGAGCATTGAATCATTAGCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-9529s21c1
Sequence:CCGGCGACGAGAACTAGCACAGAATCTCGAGATTCTGTGCTAGTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-10281s21c1
Sequence:CCGGCCTAGGCTGCAGGACTAATATCTCGAGATATTAGTCCTGCAGCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-879s21c1
Sequence:CCGGGCTAACTCGGCTACAACATTTCTCGAGAAATGTTGTAGCCGAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031407
VALIDATED
HUWE1 MISSION shRNA Lentiviral Transduction Particles
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073306    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-6230s1c1
Sequence:CCGGCGACGAGAACTAGCACAGAATCTCGAGATTCTGTGCTAGTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073304    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-1411s1c1
Sequence:CCGGCCACACTTTCACAGATACTATCTCGAGATAGTATCTGTGAAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073303    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-10700s1c1
Sequence:CCGGGCGTCTGTGTTGTGGAGGTTTCTCGAGAAACCTCCACAACACAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073307    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_031407.2-6916s1c1
Sequence:CCGGGCTACACAAGATGGAGTCAAACTCGAGTTTGACTCCATCTTGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073305    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_031407.2-5585s1c1
Sequence:CCGGGCTCCCACTATAACCTCACTTCTCGAGAAGTGAGGTTATAGTGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-12382s21c1
Sequence:CCGGTTTGATGTCAAGCGCAAATATCTCGAGATATTTGCGCTTGACATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031407.4-13965s21c1
Sequence:CCGGTGCACAGCTAATGATTCAATGCTCGAGCATTGAATCATTAGCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-9529s21c1
Sequence:CCGGCGACGAGAACTAGCACAGAATCTCGAGATTCTGTGCTAGTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-10281s21c1
Sequence:CCGGCCTAGGCTGCAGGACTAATATCTCGAGATATTAGTCCTGCAGCCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031407.4-879s21c1
Sequence:CCGGGCTAACTCGGCTACAACATTTCTCGAGAAATGTTGTAGCCGAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021523
VALIDATED
HUWE1 MISSION shRNA Bacterial Glycerol Stock
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000347015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021523.4-14018s21c1
Sequence:CCGGTGCACAGCTAATGATTCAATGCTCGAGCATTGAATCATTAGCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-12351s21c1
Sequence:CCGGCCGCACTGTGTTAAACCAGATCTCGAGATCTGGTTTAACACAGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-2215s21c1
Sequence:CCGGGCACTGCTCATCAAAGATGTTCTCGAGAACATCTTTGATGAGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-5817s21c1
Sequence:CCGGCCACAAATATGCCATGATGTTCTCGAGAACATCATGGCATATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021523
VALIDATED
HUWE1 MISSION shRNA shRNA Plasmid DNA
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000347015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021523.4-14018s21c1
Sequence:CCGGTGCACAGCTAATGATTCAATGCTCGAGCATTGAATCATTAGCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-12351s21c1
Sequence:CCGGCCGCACTGTGTTAAACCAGATCTCGAGATCTGGTTTAACACAGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-2215s21c1
Sequence:CCGGGCACTGCTCATCAAAGATGTTCTCGAGAACATCTTTGATGAGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-5817s21c1
Sequence:CCGGCCACAAATATGCCATGATGTTCTCGAGAACATCATGGCATATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021523
VALIDATED
HUWE1 MISSION shRNA Lentiviral Transduction Particles
HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000347015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021523.4-14018s21c1
Sequence:CCGGTGCACAGCTAATGATTCAATGCTCGAGCATTGAATCATTAGCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-12351s21c1
Sequence:CCGGCCGCACTGTGTTAAACCAGATCTCGAGATCTGGTTTAACACAGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-2215s21c1
Sequence:CCGGGCACTGCTCATCAAAGATGTTCTCGAGAACATCTTTGATGAGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021523.4-5817s21c1
Sequence:CCGGCCACAAATATGCCATGATGTTCTCGAGAACATCATGGCATATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)