EMAIL THIS PAGE TO A FRIEND

HVCN1

hydrogen voltage-gated channel 1

77 Gene Product Result for
Synonyms: HV1 VSOP
UniProtKB ID: Q96D96, A8MQ37, B4DEB3, F8WCH5, Q6UW11, Q96IS5
Gene ID:
Human(84329) Summary: This gene encodes a voltage-gated protein channel protein expressed more highly in certain cells of the immune system. Phagocytic cells produce superoxide anions which require this channel protein, and in B cells this same process facilitates antibody production. This same channel protein, however, can also regulate functions in other cells including spermatozoa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(74096) hydrogen voltage-gated channel 1
Rat(304485) hydrogen voltage-gated channel 1
Zebrafish(436618) hydrogen voltage-gated channel 1
chicken(416871) hydrogen voltage-gated channel 1
cow(616570) hydrogen voltage-gated channel 1
domestic cat(101081003) hydrogen voltage-gated channel 1
dog(608547) hydrogen voltage-gated channel 1
sheep(101104785) hydrogen voltage-gated channel 1
domestic guinea pig(100718825) hydrogen voltage-gated channel 1
naked mole-rat(101715676) hydrogen voltage-gated channel 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040107 Rosetta Predictions human pricing
NM_032369 Rosetta Predictions human pricing
XM_001079575 Rosetta Predictions rat pricing
XM_222187 Rosetta Predictions rat pricing
NM_001042489 Rosetta Predictions mouse pricing
NM_028752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238045 predicted 946
2 SASI_Hs01_00238046 predicted 1239
3 SASI_Hs01_00238047 predicted 1280
4 SASI_Hs01_00238048 predicted 721
5 SASI_Hs01_00238049 predicted 824
6 SASI_Hs01_00238050 predicted 681
7 SASI_Hs01_00238051 predicted 1209
8 SASI_Hs01_00238052 predicted 1134
9 SASI_Hs01_00238053 predicted 892
10 SASI_Hs02_00308831 predicted 966
11 SASI_Hs01_00238054 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158076 predicted 915
2 SASI_Hs01_00158077 predicted 1214
3 SASI_Hs01_00158078 predicted 1260
4 SASI_Hs01_00158079 predicted 701
5 SASI_Hs01_00158080 predicted 807
6 SASI_Hs01_00158081 predicted 652
7 SASI_Hs01_00158082 predicted 1180
8 SASI_Hs01_00158083 predicted 1116
9 SASI_Hs01_00158084 predicted 863
10 SASI_Hs02_00359755 predicted 937
11 SASI_Hs01_00158085 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364733 predicted 463
2 SASI_Rn02_00364734 predicted 606
3 SASI_Rn02_00364735 predicted 611
4 SASI_Rn02_00364736 predicted 460
5 SASI_Rn02_00364737 predicted 337
6 SASI_Rn02_00364738 predicted 513
7 SASI_Rn02_00364739 predicted 463
8 SASI_Rn02_00364740 predicted 416
9 SASI_Rn02_00364741 predicted 569
10 SASI_Rn02_00364742 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162930 predicted 1209
2 SASI_Rn01_00162931 predicted 297
3 SASI_Rn01_00162932 predicted 413
4 SASI_Rn01_00162933 predicted 440
5 SASI_Rn01_00162934 predicted 1205
6 SASI_Rn01_00162935 predicted 1291
7 SASI_Rn01_00162936 predicted 1080
8 SASI_Rn01_00162937 predicted 282
9 SASI_Rn01_00162938 predicted 303
10 SASI_Rn01_00162939 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290435 predicted 1597
2 SASI_Mm02_00290436 predicted 1063
3 SASI_Mm02_00290437 predicted 683
4 SASI_Mm02_00290438 predicted 1318
5 SASI_Mm02_00290439 predicted 612
6 SASI_Mm02_00290440 predicted 1050
7 SASI_Mm02_00290441 predicted 1561
8 SASI_Mm02_00290442 predicted 1595
9 SASI_Mm02_00290443 predicted 1322
10 SASI_Mm02_00290444 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193650 predicted 1457
2 SASI_Mm01_00193652 predicted 927
3 SASI_Mm01_00193653 predicted 544
4 SASI_Mm02_00334332 predicted 1177
5 SASI_Mm02_00334333 predicted 472
6 SASI_Mm01_00193655 predicted 913
7 SASI_Mm01_00193656 predicted 1423
8 SASI_Mm01_00193657 predicted 1461
9 SASI_Mm01_00193658 predicted 1178
10 SASI_Mm01_00193659 predicted 471
11 SASI_Mm01_00193651 predicted 747
12 SASI_Mm01_00193654 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032369
VALIDATED
HVCN1 MISSION shRNA Bacterial Glycerol Stock
hydrogen voltage-gated channel 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1076s21c1
Sequence:CCGGGTGAGAGGTTTGGTTTGATACCTCGAGGTATCAAACCAAACCTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032369.2-461s21c1
Sequence:CCGGACAGGTTTCAGGTCATCATCACTCGAGTGATGATGACCTGAAACCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1260s21c1
Sequence:CCGGTGGACAATTGCTAGTTGTATACTCGAGTATACAACTAGCAATTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1213s21c1
Sequence:CCGGTTCTCATGTTGAACACTTTAGCTCGAGCTAAAGTGTTCAACATGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032369.1-1262s1c1
Sequence:CCGGCCCGGATCATCAATGGGATTACTCGAGTAATCCCATTGATGATCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1300s1c1
Sequence:CCGGCGTTCAGAACGGCAACTCTTACTCGAGTAAGAGTTGCCGTTCTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032369.1-1015s1c1
Sequence:CCGGCAGCCCGACAAGAATAACTATCTCGAGATAGTTATTCTTGTCGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1263s1c1
Sequence:CCGGCCGGATCATCAATGGGATTATCTCGAGATAATCCCATTGATGATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1135s1c1
Sequence:CCGGCACAAGTTTGAGATCCTGGATCTCGAGATCCAGGATCTCAAACTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032369.1-1171s1c1
Sequence:CCGGGTCTCATTCATCCTCGACATTCTCGAGAATGTCGAGGATGAATGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032369
VALIDATED
HVCN1 MISSION shRNA shRNA Plasmid DNA
hydrogen voltage-gated channel 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1076s21c1
Sequence:CCGGGTGAGAGGTTTGGTTTGATACCTCGAGGTATCAAACCAAACCTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032369.2-461s21c1
Sequence:CCGGACAGGTTTCAGGTCATCATCACTCGAGTGATGATGACCTGAAACCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1260s21c1
Sequence:CCGGTGGACAATTGCTAGTTGTATACTCGAGTATACAACTAGCAATTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1213s21c1
Sequence:CCGGTTCTCATGTTGAACACTTTAGCTCGAGCTAAAGTGTTCAACATGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032369.1-1262s1c1
Sequence:CCGGCCCGGATCATCAATGGGATTACTCGAGTAATCCCATTGATGATCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1300s1c1
Sequence:CCGGCGTTCAGAACGGCAACTCTTACTCGAGTAAGAGTTGCCGTTCTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032369.1-1015s1c1
Sequence:CCGGCAGCCCGACAAGAATAACTATCTCGAGATAGTTATTCTTGTCGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1263s1c1
Sequence:CCGGCCGGATCATCAATGGGATTATCTCGAGATAATCCCATTGATGATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1135s1c1
Sequence:CCGGCACAAGTTTGAGATCCTGGATCTCGAGATCCAGGATCTCAAACTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032369.1-1171s1c1
Sequence:CCGGGTCTCATTCATCCTCGACATTCTCGAGAATGTCGAGGATGAATGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032369
VALIDATED
HVCN1 MISSION shRNA Lentiviral Transduction Particles
hydrogen voltage-gated channel 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1076s21c1
Sequence:CCGGGTGAGAGGTTTGGTTTGATACCTCGAGGTATCAAACCAAACCTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032369.2-461s21c1
Sequence:CCGGACAGGTTTCAGGTCATCATCACTCGAGTGATGATGACCTGAAACCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1260s21c1
Sequence:CCGGTGGACAATTGCTAGTTGTATACTCGAGTATACAACTAGCAATTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032369.2-1213s21c1
Sequence:CCGGTTCTCATGTTGAACACTTTAGCTCGAGCTAAAGTGTTCAACATGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032369.1-1262s1c1
Sequence:CCGGCCCGGATCATCAATGGGATTACTCGAGTAATCCCATTGATGATCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1300s1c1
Sequence:CCGGCGTTCAGAACGGCAACTCTTACTCGAGTAAGAGTTGCCGTTCTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032369.1-1015s1c1
Sequence:CCGGCAGCCCGACAAGAATAACTATCTCGAGATAGTTATTCTTGTCGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1263s1c1
Sequence:CCGGCCGGATCATCAATGGGATTATCTCGAGATAATCCCATTGATGATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032369.1-1135s1c1
Sequence:CCGGCACAAGTTTGAGATCCTGGATCTCGAGATCCAGGATCTCAAACTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032369.1-1171s1c1
Sequence:CCGGGTCTCATTCATCCTCGACATTCTCGAGAATGTCGAGGATGAATGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028752
HVCN1 MISSION shRNA Bacterial Glycerol Stock
hydrogen voltage-gated channel 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028752.1-329s1c1
Sequence:CCGGGTGGAATGTCAACTACAAGAACTCGAGTTCTTGTAGTTGACATTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028752.1-1678s1c1
Sequence:CCGGGCTGGTTTGTACCTCTCAAATCTCGAGATTTGAGAGGTACAAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028752.1-1462s1c1
Sequence:CCGGGCAGCTCTTTCAGTTACTGTACTCGAGTACAGTAACTGAAAGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028752.1-500s1c1
Sequence:CCGGCCACAGGTTTCAGGTCATCATCTCGAGATGATGACCTGAAACCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028752.1-1613s1c1
Sequence:CCGGCCCTGTAATTAGCACAATCTTCTCGAGAAGATTGTGCTAATTACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028752.1-890s1c1
Sequence:CCGGCTTAAGGCTAAAGCAGATAAACTCGAGTTTATCTGCTTTAGCCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028752
HVCN1 MISSION shRNA shRNA Plasmid DNA
hydrogen voltage-gated channel 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028752.1-329s1c1
Sequence:CCGGGTGGAATGTCAACTACAAGAACTCGAGTTCTTGTAGTTGACATTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028752.1-1678s1c1
Sequence:CCGGGCTGGTTTGTACCTCTCAAATCTCGAGATTTGAGAGGTACAAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028752.1-1462s1c1
Sequence:CCGGGCAGCTCTTTCAGTTACTGTACTCGAGTACAGTAACTGAAAGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028752.1-500s1c1
Sequence:CCGGCCACAGGTTTCAGGTCATCATCTCGAGATGATGACCTGAAACCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028752.1-1613s1c1
Sequence:CCGGCCCTGTAATTAGCACAATCTTCTCGAGAAGATTGTGCTAATTACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028752.1-890s1c1
Sequence:CCGGCTTAAGGCTAAAGCAGATAAACTCGAGTTTATCTGCTTTAGCCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028752
HVCN1 MISSION shRNA Lentiviral Transduction Particles
hydrogen voltage-gated channel 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028752.1-329s1c1
Sequence:CCGGGTGGAATGTCAACTACAAGAACTCGAGTTCTTGTAGTTGACATTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028752.1-1678s1c1
Sequence:CCGGGCTGGTTTGTACCTCTCAAATCTCGAGATTTGAGAGGTACAAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028752.1-1462s1c1
Sequence:CCGGGCAGCTCTTTCAGTTACTGTACTCGAGTACAGTAACTGAAAGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028752.1-500s1c1
Sequence:CCGGCCACAGGTTTCAGGTCATCATCTCGAGATGATGACCTGAAACCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028752.1-1613s1c1
Sequence:CCGGCCCTGTAATTAGCACAATCTTCTCGAGAAGATTGTGCTAATTACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028752.1-890s1c1
Sequence:CCGGCTTAAGGCTAAAGCAGATAAACTCGAGTTTATCTGCTTTAGCCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)