EMAIL THIS PAGE TO A FRIEND

HYAL1

hyaluronoglucosaminidase 1

136 Gene Product Result for
Synonyms: HYAL-1 LUCA1 NAT6
Gene ID:
Human(3373) Summary: This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15586) hyaluronoglucosaminidase 1
Rat(367166) hyaluronoglucosaminidase 1
sheep(101121207) hyaluronoglucosaminidase 1
domestic guinea pig(100716200) hyaluronoglucosaminidase 1
naked mole-rat(101701149) hyaluronoglucosaminidase 1
chicken(426739) hyaluronoglucosaminidase 1
dog(608602) hyaluronoglucosaminidase 1
cow(515397) hyaluronoglucosaminidase 1
Horse(100061875) hyaluronoglucosaminidase 1
domestic cat(101093422) hyaluronoglucosaminidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007312 Rosetta Predictions human pricing
NM_033159 Rosetta Predictions human pricing
NM_153281 Rosetta Predictions human pricing
NM_153282 Rosetta Predictions human pricing
NM_153283 Rosetta Predictions human pricing
NM_153284 Rosetta Predictions human pricing
NM_153285 Rosetta Predictions human pricing
NM_153286 Rosetta Predictions human pricing
NM_207616 Rosetta Predictions rat pricing
NM_008317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015535 predicted 1932
2 SASI_Hs01_00015537 predicted 1846
3 SASI_Hs01_00015538 predicted 1931
4 SASI_Hs01_00015539 predicted 1995
5 SASI_Hs01_00015540 predicted 1991
6 SASI_Hs01_00015541 predicted 1922
7 SASI_Hs01_00015542 predicted 1903
8 SASI_Hs01_00015543 predicted 1915
9 SASI_Hs01_00015544 predicted 1929
10 SASI_Hs02_00343382 predicted 1836
11 SASI_Hs01_00015536 predicted 1848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106538 predicted 1450
2 SASI_Hs01_00106540 predicted 1365
3 SASI_Hs01_00106541 predicted 1443
4 SASI_Hs01_00106542 predicted 1442
5 SASI_Hs02_00360896 predicted 1414
6 SASI_Hs01_00106544 predicted 1422
7 SASI_Hs01_00106545 predicted 1428
8 SASI_Hs01_00106546 predicted 1436
9 SASI_Hs01_00106547 predicted 1356
10 SASI_Hs02_00360897 predicted 1451
11 SASI_Hs01_00106539 predicted 1365
12 SASI_Hs01_00106543 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190327 predicted 1740
2 SASI_Hs01_00190329 predicted 1657
3 SASI_Hs01_00190330 predicted 1736
4 SASI_Hs01_00190333 predicted 1730
5 SASI_Hs02_00367156 predicted 1705
6 SASI_Hs01_00190334 predicted 1718
7 SASI_Hs01_00190335 predicted 1722
8 SASI_Hs01_00190336 predicted 1737
9 SASI_Hs02_00367157 predicted 1654
10 SASI_Hs02_00367158 predicted 1746
11 SASI_Hs01_00190328 predicted 1661
12 SASI_Hs01_00190331 predicted 1810
13 SASI_Hs01_00190332 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135724 predicted 1360
2 SASI_Hs01_00135726 predicted 1277
3 SASI_Hs01_00135727 predicted 1354
4 SASI_Hs02_00367159 predicted 1425
5 SASI_Hs02_00367160 predicted 1412
6 SASI_Hs01_00135728 predicted 1344
7 SASI_Hs01_00135730 predicted 1331
8 SASI_Hs01_00135731 predicted 1345
9 SASI_Hs01_00135732 predicted 1352
10 SASI_Hs01_00135733 predicted 1260
11 SASI_Hs01_00135725 predicted 1273
12 SASI_Hs01_00135729 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053278 predicted 1094
2 SASI_Hs01_00053280 predicted 1010
3 SASI_Hs01_00053281 predicted 1082
4 SASI_Hs02_00367161 predicted 1161
5 SASI_Hs02_00367162 predicted 1149
6 SASI_Hs01_00053282 predicted 1083
7 SASI_Hs01_00053284 predicted 1064
8 SASI_Hs01_00053285 predicted 1074
9 SASI_Hs01_00053286 predicted 1084
10 SASI_Hs01_00053287 predicted 998
11 SASI_Hs01_00053279 predicted 1008
12 SASI_Hs01_00053283 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180627 predicted 1113
2 SASI_Hs01_00180628 predicted 1027
3 SASI_Hs01_00180629 predicted 1037
4 SASI_Hs01_00180630 predicted 1110
5 SASI_Hs01_00180631 predicted 1111
6 SASI_Hs01_00180632 predicted 1149
7 SASI_Hs01_00180633 predicted 1083
8 SASI_Hs01_00180634 predicted 1098
9 SASI_Hs01_00180635 predicted 1111
10 SASI_Hs01_00180636 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150985 predicted 670
2 SASI_Hs01_00150987 predicted 591
3 SASI_Hs01_00150988 predicted 672
4 SASI_Hs01_00150989 predicted 736
5 SASI_Hs01_00150990 predicted 732
6 SASI_Hs01_00150991 predicted 661
7 SASI_Hs01_00150992 predicted 648
8 SASI_Hs01_00150993 predicted 659
9 SASI_Hs01_00150994 predicted 664
10 SASI_Hs02_00367163 predicted 582
11 SASI_Hs01_00150986 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209376 predicted 526
2 SASI_Hs01_00209377 predicted 439
3 SASI_Hs01_00209378 predicted 440
4 SASI_Hs01_00209379 predicted 521
5 SASI_Hs01_00209380 predicted 516
6 SASI_Hs01_00209381 predicted 565
7 SASI_Hs01_00209382 predicted 497
8 SASI_Hs01_00209383 predicted 510
9 SASI_Hs01_00209384 predicted 524
10 SASI_Hs01_00209385 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048309 predicted 1028
2 SASI_Rn01_00048310 predicted 709
3 SASI_Rn01_00048311 predicted 519
4 SASI_Rn01_00048312 predicted 1070
5 SASI_Rn01_00048313 predicted 1039
6 SASI_Rn01_00048315 predicted 894
7 SASI_Rn01_00048316 predicted 815
8 SASI_Rn01_00048317 predicted 793
9 SASI_Rn01_00048318 predicted 476
10 SASI_Rn02_00270450 predicted 525
11 SASI_Rn01_00048314 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132519 predicted 265
2 SASI_Mm01_00132523 predicted 1148
3 SASI_Mm01_00132520 predicted 816
4 SASI_Mm01_00132521 predicted 239
5 SASI_Mm01_00132522 predicted 583
6 SASI_Mm02_00313632 predicted 334
7 SASI_Mm01_00132524 predicted 743
8 SASI_Mm01_00132525 predicted 925
9 SASI_Mm01_00132526 predicted 1133
10 SASI_Mm01_00132528 predicted 1535
11 SASI_Mm01_00132527 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007312
HYAL1 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007312.3-1036s21c1
Sequence:CCGGACTGGGACACCAAGGACATTTCTCGAGAAATGTCCTTGGTGTCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007312.3-1616s21c1
Sequence:CCGGTCAGGCCATCAAGGAGTATATCTCGAGATATACTCCTTGATGGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007312.3-2042s21c1
Sequence:CCGGGCCACTGTCACAGGCATATTCCTCGAGGAATATGCCTGTGACAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1237s1c1
Sequence:CCGGGCTACAACTATGACTTTCTAACTCGAGTTAGAAAGTCATAGTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-774s1c1
Sequence:CCGGGTCAGTGTCTTCGATGTGGTACTCGAGTACCACATCGAAGACACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-650s1c1
Sequence:CCGGCTTCCTGACCTTACTCGATATCTCGAGATATCGAGTAAGGTCAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1854s1c1
Sequence:CCGGGCTGTGGAGTTCAAATGTCGACTCGAGTCGACATTTGAACTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1379s1c1
Sequence:CCGGCACAGGGAAGTCACAGATGTACTCGAGTACATCTGTGACTTCCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007312
HYAL1 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007312.3-1036s21c1
Sequence:CCGGACTGGGACACCAAGGACATTTCTCGAGAAATGTCCTTGGTGTCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007312.3-1616s21c1
Sequence:CCGGTCAGGCCATCAAGGAGTATATCTCGAGATATACTCCTTGATGGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007312.3-2042s21c1
Sequence:CCGGGCCACTGTCACAGGCATATTCCTCGAGGAATATGCCTGTGACAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1237s1c1
Sequence:CCGGGCTACAACTATGACTTTCTAACTCGAGTTAGAAAGTCATAGTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-774s1c1
Sequence:CCGGGTCAGTGTCTTCGATGTGGTACTCGAGTACCACATCGAAGACACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-650s1c1
Sequence:CCGGCTTCCTGACCTTACTCGATATCTCGAGATATCGAGTAAGGTCAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1854s1c1
Sequence:CCGGGCTGTGGAGTTCAAATGTCGACTCGAGTCGACATTTGAACTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1379s1c1
Sequence:CCGGCACAGGGAAGTCACAGATGTACTCGAGTACATCTGTGACTTCCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007312
HYAL1 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007312.3-1036s21c1
Sequence:CCGGACTGGGACACCAAGGACATTTCTCGAGAAATGTCCTTGGTGTCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007312.3-1616s21c1
Sequence:CCGGTCAGGCCATCAAGGAGTATATCTCGAGATATACTCCTTGATGGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007312.3-2042s21c1
Sequence:CCGGGCCACTGTCACAGGCATATTCCTCGAGGAATATGCCTGTGACAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1237s1c1
Sequence:CCGGGCTACAACTATGACTTTCTAACTCGAGTTAGAAAGTCATAGTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-774s1c1
Sequence:CCGGGTCAGTGTCTTCGATGTGGTACTCGAGTACCACATCGAAGACACTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-650s1c1
Sequence:CCGGCTTCCTGACCTTACTCGATATCTCGAGATATCGAGTAAGGTCAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1854s1c1
Sequence:CCGGGCTGTGGAGTTCAAATGTCGACTCGAGTCGACATTTGAACTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007312.3-1379s1c1
Sequence:CCGGCACAGGGAAGTCACAGATGTACTCGAGTACATCTGTGACTTCCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008317
VALIDATED
HYAL1 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000055368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008317.2-782s1c1
Sequence:CCGGCGACTTTCTAAGTCTCAACTACTCGAGTAGTTGAGACTTAGAAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-1151s1c1
Sequence:CCGGCCAGGCCATTAAAGCATACATCTCGAGATGTATGCTTTAATGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-350s1c1
Sequence:CCGGCCAAGGCTCTAACATGACAATCTCGAGATTGTCATGTTAGAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-167s1c1
Sequence:CCGGGCTTCGCATCTCTACTCTCTTCTCGAGAAGAGAGTAGAGATGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008317
VALIDATED
HYAL1 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000055368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008317.2-782s1c1
Sequence:CCGGCGACTTTCTAAGTCTCAACTACTCGAGTAGTTGAGACTTAGAAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-1151s1c1
Sequence:CCGGCCAGGCCATTAAAGCATACATCTCGAGATGTATGCTTTAATGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-350s1c1
Sequence:CCGGCCAAGGCTCTAACATGACAATCTCGAGATTGTCATGTTAGAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-167s1c1
Sequence:CCGGGCTTCGCATCTCTACTCTCTTCTCGAGAAGAGAGTAGAGATGCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008317
VALIDATED
HYAL1 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000055368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008317.2-782s1c1
Sequence:CCGGCGACTTTCTAAGTCTCAACTACTCGAGTAGTTGAGACTTAGAAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-1151s1c1
Sequence:CCGGCCAGGCCATTAAAGCATACATCTCGAGATGTATGCTTTAATGGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-350s1c1
Sequence:CCGGCCAAGGCTCTAACATGACAATCTCGAGATTGTCATGTTAGAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008317.2-167s1c1
Sequence:CCGGGCTTCGCATCTCTACTCTCTTCTCGAGAAGAGAGTAGAGATGCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)