EMAIL THIS PAGE TO A FRIEND

HYAL2

hyaluronoglucosaminidase 2

87 Gene Product Result for
Synonyms: LUCA2
UniProtKB ID: Q12891, B3KRZ2, O15177, Q9BW29
Gene ID:
Human(8692) Summary: This gene encodes a weak acid-active hyaluronidase. The encoded protein is similar in structure to other more active hyaluronidases. Hyaluronidases degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan and fragments of hyaluronan are thought to be involved in cell proliferation, migration and differentiation. Although it was previously thought to be a lysosomal hyaluronidase that is active at a pH below 4, the encoded protein is likely a GPI-anchored cell surface protein. This hyaluronidase serves as a receptor for the oncogenic virus Jaagsiekte sheep retrovirus. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes two alternatively spliced transcript variants which differ only in the 5' UTR.[provided by RefSeq, Mar 2010]
Mouse(15587) hyaluronoglucosaminidase 2
Rat(64468) hyaluronoglucosaminidase 2
Zebrafish(559228) hyaluronoglucosaminidase 2
chicken(415908) hyaluronoglucosaminidase 2
domestic cat(101094000) hyaluronoglucosaminidase 2
dog(484760) hyaluronoglucosaminidase 2
Horse(100061845) hyaluronoglucosaminidase 2
cow(281838) hyaluronoglucosaminidase 2
domestic guinea pig(100716485) hyaluronoglucosaminidase 2
naked mole-rat(101709759) hyaluronoglucosaminidase 2
sheep(443154) hyaluronoglucosaminidase 2
Domestic Rabbit(100009375) hyaluronoglucosaminidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003773 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003773 Rosetta Predictions human pricing
NM_033158 Rosetta Predictions human pricing
NM_172040 Rosetta Predictions rat pricing
NM_010489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087050 predicted 560
2 SASI_Hs01_00087051 predicted 1337
3 SASI_Hs01_00087052 predicted 1502
4 SASI_Hs01_00087053 predicted 1534
5 SASI_Hs02_00336267 predicted 599
6 SASI_Hs01_00087055 predicted 1284
7 SASI_Hs01_00087056 predicted 512
8 SASI_Hs02_00336268 predicted 1411
9 SASI_Hs01_00087059 predicted 1572
10 SASI_Hs02_00336269 predicted 349
11 SASI_Hs01_00087054 predicted 548
12 SASI_Hs01_00087057 predicted 729
13 SASI_Hs01_00087058 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241216 predicted 601
2 SASI_Hs01_00241217 predicted 1379
3 SASI_Hs01_00241218 predicted 1543
4 SASI_Hs01_00241219 predicted 1572
5 SASI_Hs02_00360893 predicted 642
6 SASI_Hs01_00241221 predicted 1332
7 SASI_Hs01_00241222 predicted 557
8 SASI_Hs02_00360894 predicted 1453
9 SASI_Hs01_00241225 predicted 1617
10 SASI_Hs02_00360895 predicted 394
11 SASI_Hs01_00241220 predicted 595
12 SASI_Hs01_00241223 predicted 773
13 SASI_Hs01_00241224 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033591 predicted 588
2 SASI_Rn01_00033592 predicted 366
3 SASI_Rn01_00033593 predicted 772
4 SASI_Rn01_00033594 predicted 1405
5 SASI_Rn02_00269133 predicted 259
6 SASI_Rn01_00033596 predicted 565
7 SASI_Rn01_00033600 predicted 1126
8 SASI_Rn01_00033598 predicted 922
9 SASI_Rn01_00033597 predicted 940
10 SASI_Rn02_00269134 predicted 786
11 SASI_Rn01_00033595 predicted 984
12 SASI_Rn01_00033599 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166124 predicted 1386
2 SASI_Mm01_00166125 predicted 546
3 SASI_Mm01_00166126 predicted 1134
4 SASI_Mm01_00166127 predicted 555
5 SASI_Mm01_00166128 predicted 986
6 SASI_Mm01_00166129 predicted 746
7 SASI_Mm01_00166130 predicted 910
8 SASI_Mm01_00166132 predicted 1119
9 SASI_Mm01_00166133 predicted 536
10 SASI_Mm02_00318730 predicted 730
11 SASI_Mm01_00166131 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003773
HYAL2 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-460s21c1
Sequence:CCGGCCAGAATATTACCATCTTCTACTCGAGTAGAAGATGGTAATATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-1156s21c1
Sequence:CCGGGCTTAGTGAGATGGACCTCATCTCGAGATGAGGTCCATCTCACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-753s21c1
Sequence:CCGGGCATAGTCAAACAGGCACAATCTCGAGATTGTGCCTGTTTGACTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-615s1c1
Sequence:CCGGGCATAGTCAAACAGGCACAATCTCGAGATTGTGCCTGTTTGACTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-1122s1c1
Sequence:CCGGCCTGCCAGTACCTCAAAGATTCTCGAGAATCTTTGAGGTACTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-1018s1c1
Sequence:CCGGGCTTAGTGAGATGGACCTCATCTCGAGATGAGGTCCATCTCACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-322s1c1
Sequence:CCGGCCAGAATATTACCATCTTCTACTCGAGTAGAAGATGGTAATATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-269s1c1
Sequence:CCGGCTGGACCTGAATGCCTTTGATCTCGAGATCAAAGGCATTCAGGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-407s21c1
Sequence:CCGGCTGGACCTGAATGCCTTTGATCTCGAGATCAAAGGCATTCAGGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-1260s21c1
Sequence:CCGGCCTGCCAGTACCTCAAAGATTCTCGAGAATCTTTGAGGTACTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003773
HYAL2 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-460s21c1
Sequence:CCGGCCAGAATATTACCATCTTCTACTCGAGTAGAAGATGGTAATATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-1156s21c1
Sequence:CCGGGCTTAGTGAGATGGACCTCATCTCGAGATGAGGTCCATCTCACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-753s21c1
Sequence:CCGGGCATAGTCAAACAGGCACAATCTCGAGATTGTGCCTGTTTGACTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-615s1c1
Sequence:CCGGGCATAGTCAAACAGGCACAATCTCGAGATTGTGCCTGTTTGACTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-1122s1c1
Sequence:CCGGCCTGCCAGTACCTCAAAGATTCTCGAGAATCTTTGAGGTACTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-1018s1c1
Sequence:CCGGGCTTAGTGAGATGGACCTCATCTCGAGATGAGGTCCATCTCACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-322s1c1
Sequence:CCGGCCAGAATATTACCATCTTCTACTCGAGTAGAAGATGGTAATATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-269s1c1
Sequence:CCGGCTGGACCTGAATGCCTTTGATCTCGAGATCAAAGGCATTCAGGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-407s21c1
Sequence:CCGGCTGGACCTGAATGCCTTTGATCTCGAGATCAAAGGCATTCAGGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-1260s21c1
Sequence:CCGGCCTGCCAGTACCTCAAAGATTCTCGAGAATCTTTGAGGTACTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003773
HYAL2 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-460s21c1
Sequence:CCGGCCAGAATATTACCATCTTCTACTCGAGTAGAAGATGGTAATATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-1156s21c1
Sequence:CCGGGCTTAGTGAGATGGACCTCATCTCGAGATGAGGTCCATCTCACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-753s21c1
Sequence:CCGGGCATAGTCAAACAGGCACAATCTCGAGATTGTGCCTGTTTGACTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-615s1c1
Sequence:CCGGGCATAGTCAAACAGGCACAATCTCGAGATTGTGCCTGTTTGACTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-1122s1c1
Sequence:CCGGCCTGCCAGTACCTCAAAGATTCTCGAGAATCTTTGAGGTACTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-1018s1c1
Sequence:CCGGGCTTAGTGAGATGGACCTCATCTCGAGATGAGGTCCATCTCACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-322s1c1
Sequence:CCGGCCAGAATATTACCATCTTCTACTCGAGTAGAAGATGGTAATATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003773.2-269s1c1
Sequence:CCGGCTGGACCTGAATGCCTTTGATCTCGAGATCAAAGGCATTCAGGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-407s21c1
Sequence:CCGGCTGGACCTGAATGCCTTTGATCTCGAGATCAAAGGCATTCAGGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003773.3-1260s21c1
Sequence:CCGGCCTGCCAGTACCTCAAAGATTCTCGAGAATCTTTGAGGTACTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010489
VALIDATED
HYAL2 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1651s1c1
Sequence:CCGGGATGCTTAGCAGAGCACCCATCTCGAGATGGGTGCTCTGCTAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-333s1c1
Sequence:CCGGCCAGAATATCACCACCTTCTACTCGAGTAGAAGGTGGTGATATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1425s1c1
Sequence:CCGGGCAGTGCCAACGGAACTATAACTCGAGTTATAGTTCCGTTGGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1133s1c1
Sequence:CCGGCCTGCCAATACCTCAAGAATTCTCGAGAATTCTTGAGGTATTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-745s21c1
Sequence:CCGGGACTGCTACAATCACGATTATCTCGAGATAATCGTGATTGTAGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010489.2-615s1c1
Sequence:CCGGGCCATCAGACAGAGTAATGAACTCGAGTTCATTACTCTGTCTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-907s21c1
Sequence:CCGGAGCCGCAACTTTGTCAGTTTCCTCGAGGAAACTGACAAAGTTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-1029s21c1
Sequence:CCGGACTGAGCCAGGTGGACCTTATCTCGAGATAAGGTCCACCTGGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010489.2-1574s21c1
Sequence:CCGGCTCTGGTGCAAGGATCTCCTTCTCGAGAAGGAGATCCTTGCACCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-1108s21c1
Sequence:CCGGTCGGAAGACGCTTCAAGTATGCTCGAGCATACTTGAAGCGTCTTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010489
VALIDATED
HYAL2 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1651s1c1
Sequence:CCGGGATGCTTAGCAGAGCACCCATCTCGAGATGGGTGCTCTGCTAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-333s1c1
Sequence:CCGGCCAGAATATCACCACCTTCTACTCGAGTAGAAGGTGGTGATATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1425s1c1
Sequence:CCGGGCAGTGCCAACGGAACTATAACTCGAGTTATAGTTCCGTTGGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1133s1c1
Sequence:CCGGCCTGCCAATACCTCAAGAATTCTCGAGAATTCTTGAGGTATTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-745s21c1
Sequence:CCGGGACTGCTACAATCACGATTATCTCGAGATAATCGTGATTGTAGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010489.2-615s1c1
Sequence:CCGGGCCATCAGACAGAGTAATGAACTCGAGTTCATTACTCTGTCTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-907s21c1
Sequence:CCGGAGCCGCAACTTTGTCAGTTTCCTCGAGGAAACTGACAAAGTTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-1029s21c1
Sequence:CCGGACTGAGCCAGGTGGACCTTATCTCGAGATAAGGTCCACCTGGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010489.2-1574s21c1
Sequence:CCGGCTCTGGTGCAAGGATCTCCTTCTCGAGAAGGAGATCCTTGCACCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-1108s21c1
Sequence:CCGGTCGGAAGACGCTTCAAGTATGCTCGAGCATACTTGAAGCGTCTTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010489
VALIDATED
HYAL2 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1651s1c1
Sequence:CCGGGATGCTTAGCAGAGCACCCATCTCGAGATGGGTGCTCTGCTAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-333s1c1
Sequence:CCGGCCAGAATATCACCACCTTCTACTCGAGTAGAAGGTGGTGATATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1425s1c1
Sequence:CCGGGCAGTGCCAACGGAACTATAACTCGAGTTATAGTTCCGTTGGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010489.2-1133s1c1
Sequence:CCGGCCTGCCAATACCTCAAGAATTCTCGAGAATTCTTGAGGTATTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-745s21c1
Sequence:CCGGGACTGCTACAATCACGATTATCTCGAGATAATCGTGATTGTAGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010489.2-615s1c1
Sequence:CCGGGCCATCAGACAGAGTAATGAACTCGAGTTCATTACTCTGTCTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-907s21c1
Sequence:CCGGAGCCGCAACTTTGTCAGTTTCCTCGAGGAAACTGACAAAGTTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-1029s21c1
Sequence:CCGGACTGAGCCAGGTGGACCTTATCTCGAGATAAGGTCCACCTGGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010489.2-1574s21c1
Sequence:CCGGCTCTGGTGCAAGGATCTCCTTCTCGAGAAGGAGATCCTTGCACCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010489.2-1108s21c1
Sequence:CCGGTCGGAAGACGCTTCAAGTATGCTCGAGCATACTTGAAGCGTCTTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)