EMAIL THIS PAGE TO A FRIEND

HYAL3

hyaluronoglucosaminidase 3

46 Gene Product Result for
Synonyms: HYAL-3 LUCA-3 LUCA3
Gene ID:
Human(8372) Summary: This gene encodes a member of the hyaluronidase family. Hyaluronidases are endoglycosidase enzymes that degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. The regulated turnover of hyaluronan plays a critical role in many biological processes including cell proliferation, migration and differentiation. The encoded protein may also play an important role in sperm function. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression, and the expression of specific transcript variants may be indicative of tumor status. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and some isoforms may lack hyaluronidase activity. This gene overlaps and is on the same strand as N-acetyltransferase 6 (GCN5-related), and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Mouse(109685) hyaluronoglucosaminidase 3
Rat(300993) hyaluronoglucosaminidase 3
sheep(101121461) hyaluronoglucosaminidase 3
Domestic Rabbit(100339482) hyaluronoglucosaminidase 3
domestic guinea pig(101789144) hyaluronoglucosaminidase 3
naked mole-rat(101701738) hyaluronoglucosaminidase 3
Zebrafish(100004557) hyaluronoglucosaminidase 3
chicken(100859903) hyaluronoglucosaminidase 3
dog(608620) hyaluronoglucosaminidase 3
cow(616562) hyaluronoglucosaminidase 3
Horse(100061939) hyaluronoglucosaminidase 3
domestic cat(101092920) hyaluronoglucosaminidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092871 MISSION® esiRNA esiRNA human HYAL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003549 Rosetta Predictions human pricing
NM_207599 Rosetta Predictions rat pricing
NM_178020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083127 predicted 421
2 SASI_Hs01_00083129 predicted 770
3 SASI_Hs01_00083130 predicted 404
4 SASI_Hs02_00335821 predicted 1588
5 SASI_Hs01_00083131 predicted 1603
6 SASI_Hs01_00083132 predicted 495
7 SASI_Hs01_00083133 predicted 1702
8 SASI_Hs01_00083134 predicted 938
9 SASI_Hs01_00083135 predicted 1616
10 SASI_Hs01_00083136 predicted 593
11 SASI_Hs01_00083128 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099517 predicted 363
2 SASI_Rn01_00099518 predicted 282
3 SASI_Rn01_00099519 predicted 640
4 SASI_Rn01_00099520 predicted 793
5 SASI_Rn01_00099521 predicted 598
6 SASI_Rn01_00099522 predicted 765
7 SASI_Rn01_00099523 predicted 257
8 SASI_Rn01_00099524 predicted 472
9 SASI_Rn01_00099525 predicted 854
10 SASI_Rn01_00099526 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348469 predicted 1218
2 SASI_Mm02_00348470 predicted 1356
3 SASI_Mm02_00348471 predicted 892
4 SASI_Mm02_00348472 predicted 897
5 SASI_Mm02_00348473 predicted 1311
6 SASI_Mm02_00348474 predicted 511
7 SASI_Mm02_00348475 predicted 1097
8 SASI_Mm02_00348476 predicted 764
9 SASI_Mm02_00348477 predicted 1051
10 SASI_Mm02_00348478 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003549
HYAL3 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-1431s1c1
Sequence:CCGGCCTTGGAGATTGGAAGTCCTTCTCGAGAAGGACTTCCAATCTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-469s1c1
Sequence:CCGGCACGGTCAGAACATGACCATTCTCGAGAATGGTCATGTTCTGACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-897s1c1
Sequence:CCGGCTGGCATAGTATGGCTTCCAACTCGAGTTGGAAGCCATACTATGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-1506s1c1
Sequence:CCGGTGGGCCTAAAGAAGCAGTATACTCGAGTATACTGCTTCTTTAGGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-950s1c1
Sequence:CCGGCCCGCAACACTCAACTGCATTCTCGAGAATGCAGTTGAGTGTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-765s21c1
Sequence:CCGGGCAGCTCTACAAGGCCTATACCTCGAGGTATAGGCCTTGTAGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-506s21c1
Sequence:CCGGTCGGCCTCTATCCCTACTTTGCTCGAGCAAAGTAGGGATAGAGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-428s21c1
Sequence:CCGGTCAATGCTCTGGGCATCATAGCTCGAGCTATGATGCCCAGAGCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003549
HYAL3 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-1431s1c1
Sequence:CCGGCCTTGGAGATTGGAAGTCCTTCTCGAGAAGGACTTCCAATCTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-469s1c1
Sequence:CCGGCACGGTCAGAACATGACCATTCTCGAGAATGGTCATGTTCTGACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-897s1c1
Sequence:CCGGCTGGCATAGTATGGCTTCCAACTCGAGTTGGAAGCCATACTATGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-1506s1c1
Sequence:CCGGTGGGCCTAAAGAAGCAGTATACTCGAGTATACTGCTTCTTTAGGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-950s1c1
Sequence:CCGGCCCGCAACACTCAACTGCATTCTCGAGAATGCAGTTGAGTGTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-765s21c1
Sequence:CCGGGCAGCTCTACAAGGCCTATACCTCGAGGTATAGGCCTTGTAGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-506s21c1
Sequence:CCGGTCGGCCTCTATCCCTACTTTGCTCGAGCAAAGTAGGGATAGAGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-428s21c1
Sequence:CCGGTCAATGCTCTGGGCATCATAGCTCGAGCTATGATGCCCAGAGCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003549
HYAL3 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-1431s1c1
Sequence:CCGGCCTTGGAGATTGGAAGTCCTTCTCGAGAAGGACTTCCAATCTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-469s1c1
Sequence:CCGGCACGGTCAGAACATGACCATTCTCGAGAATGGTCATGTTCTGACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-897s1c1
Sequence:CCGGCTGGCATAGTATGGCTTCCAACTCGAGTTGGAAGCCATACTATGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-1506s1c1
Sequence:CCGGTGGGCCTAAAGAAGCAGTATACTCGAGTATACTGCTTCTTTAGGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003549.2-950s1c1
Sequence:CCGGCCCGCAACACTCAACTGCATTCTCGAGAATGCAGTTGAGTGTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-765s21c1
Sequence:CCGGGCAGCTCTACAAGGCCTATACCTCGAGGTATAGGCCTTGTAGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-506s21c1
Sequence:CCGGTCGGCCTCTATCCCTACTTTGCTCGAGCAAAGTAGGGATAGAGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003549.2-428s21c1
Sequence:CCGGTCAATGCTCTGGGCATCATAGCTCGAGCTATGATGCCCAGAGCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178020
HYAL3 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-883s1c1
Sequence:CCGGCTCTACCTGTTCTGGCTTATTCTCGAGAATAAGCCAGAACAGGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-677s1c1
Sequence:CCGGGCATAAGATGGCTTCCAACTACTCGAGTAGTTGGAAGCCATCTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-945s1c1
Sequence:CCGGGACGACCTGATGCAGACTATTCTCGAGAATAGTCTGCATCAGGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-164s1c1
Sequence:CCGGAGCAAGATGTAAGGCCCATTTCTCGAGAAATGGGCCTTACATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-1231s1c1
Sequence:CCGGGATGCCATTGTTATTCGGGTTCTCGAGAACCCGAATAACAATGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178020
HYAL3 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-883s1c1
Sequence:CCGGCTCTACCTGTTCTGGCTTATTCTCGAGAATAAGCCAGAACAGGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-677s1c1
Sequence:CCGGGCATAAGATGGCTTCCAACTACTCGAGTAGTTGGAAGCCATCTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-945s1c1
Sequence:CCGGGACGACCTGATGCAGACTATTCTCGAGAATAGTCTGCATCAGGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-164s1c1
Sequence:CCGGAGCAAGATGTAAGGCCCATTTCTCGAGAAATGGGCCTTACATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-1231s1c1
Sequence:CCGGGATGCCATTGTTATTCGGGTTCTCGAGAACCCGAATAACAATGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178020
HYAL3 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-883s1c1
Sequence:CCGGCTCTACCTGTTCTGGCTTATTCTCGAGAATAAGCCAGAACAGGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-677s1c1
Sequence:CCGGGCATAAGATGGCTTCCAACTACTCGAGTAGTTGGAAGCCATCTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-945s1c1
Sequence:CCGGGACGACCTGATGCAGACTATTCTCGAGAATAGTCTGCATCAGGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-164s1c1
Sequence:CCGGAGCAAGATGTAAGGCCCATTTCTCGAGAAATGGGCCTTACATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178020.2-1231s1c1
Sequence:CCGGGATGCCATTGTTATTCGGGTTCTCGAGAACCCGAATAACAATGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)