EMAIL THIS PAGE TO A FRIEND

HYAL4

hyaluronoglucosaminidase 4

75 Gene Product Result for
Synonyms: CSHY
UniProtKB ID: Q2M3T9, D0VXG1, Q9UL99, Q9Y6T9
Gene ID:
Human(23553) Summary: This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Mouse(77042) hyaluronoglucosaminidase 4
Rat(404783) hyaluronoglucosaminidase 4
cow(518161) hyaluronoglucosaminidase 4
Horse(100056514) hyaluronoglucosaminidase 4
dog(475212) hyaluronoglucosaminidase 4
domestic guinea pig(100713959) hyaluronoglucosaminidase 4
naked mole-rat(101723286) hyaluronoglucosaminidase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012269 Rosetta Predictions human pricing
XM_001062033 Rosetta Predictions rat pricing
XM_578235 Rosetta Predictions rat pricing
NM_029848 Rosetta Predictions mouse pricing
XM_132998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224985 predicted 1461
2 SASI_Hs01_00224987 predicted 1133
3 SASI_Hs01_00224988 predicted 1229
4 SASI_Hs02_00343991 predicted 1109
5 SASI_Hs01_00224990 predicted 1128
6 SASI_Hs01_00224991 predicted 1246
7 SASI_Hs01_00224992 predicted 1058
8 SASI_Hs02_00343992 predicted 1509
9 SASI_Hs02_00343993 predicted 1057
10 SASI_Hs02_00343994 predicted 1409
11 SASI_Hs01_00224986 predicted 930
12 SASI_Hs01_00224989 predicted 1422
13 SASI_Hs01_00224993 predicted 1071
14 SASI_Hs01_00224994 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302149 predicted 828
2 SASI_Rn02_00302150 predicted 597
3 SASI_Rn02_00302151 predicted 520
4 SASI_Rn02_00302152 predicted 774
5 SASI_Rn02_00302153 predicted 765
6 SASI_Rn02_00302154 predicted 845
7 SASI_Rn02_00302155 predicted 495
8 SASI_Rn02_00302156 predicted 869
9 SASI_Rn02_00302157 predicted 607
10 SASI_Rn02_00302158 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131648 predicted 830
2 SASI_Rn01_00131649 predicted 598
3 SASI_Rn02_00407737 predicted 522
4 SASI_Rn01_00131650 predicted 779
5 SASI_Rn01_00131651 predicted 764
6 SASI_Rn01_00131652 predicted 845
7 SASI_Rn01_00131654 predicted 495
8 SASI_Rn01_00131655 predicted 866
9 SASI_Rn01_00131656 predicted 610
10 SASI_Rn01_00131657 predicted 424
11 SASI_Rn01_00131653 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336054 predicted 897
2 SASI_Mm02_00336055 predicted 1041
3 SASI_Mm02_00336056 predicted 1134
4 SASI_Mm02_00336057 predicted 873
5 SASI_Mm02_00336058 predicted 1642
6 SASI_Mm02_00336059 predicted 1624
7 SASI_Mm02_00336060 predicted 982
8 SASI_Mm02_00336061 predicted 811
9 SASI_Mm02_00336062 predicted 1036
10 SASI_Mm02_00336063 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210837 predicted 258
2 SASI_Mm01_00210838 predicted 919
3 SASI_Mm01_00210839 predicted 1079
4 SASI_Mm01_00210840 predicted 1166
5 SASI_Mm01_00210841 predicted 898
6 SASI_Mm01_00210842 predicted 1676
7 SASI_Mm01_00210843 predicted 1652
8 SASI_Mm01_00210844 predicted 1018
9 SASI_Mm01_00210845 predicted 843
10 SASI_Mm01_00210846 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012269
HYAL4 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-2071s21c1
Sequence:CCGGGCATTCAGTTGTGAGATAATTCTCGAGAATTATCTCACAACTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-696s21c1
Sequence:CCGGACTTCATGGCTCCTTATATTTCTCGAGAAATATAAGGAGCCATGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.2-1168s1c1
Sequence:CCGGATGTATCAGCTACCGATATTGCTCGAGCAATATCGGTAGCTGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-747s21c1
Sequence:CCGGCCTGCTCGACTTCCAATTTATCTCGAGATAAATTGGAAGTCGAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-1132s21c1
Sequence:CCGGAGAAGTCAAGAAAGCTTATTTCTCGAGAAATAAGCTTTCTTGACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012269.1-2124s1c1
Sequence:CCGGCCTAGTCATTTAAAGAAGGATCTCGAGATCCTTCTTTAAATGACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.1-975s1c1
Sequence:CCGGCTCCCACAGAACATAAGTTTACTCGAGTAAACTTATGTTCTGTGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.1-804s1c1
Sequence:CCGGCCAACAGATCAGTGTTTGATACTCGAGTATCAAACACTGATCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012269
HYAL4 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-2071s21c1
Sequence:CCGGGCATTCAGTTGTGAGATAATTCTCGAGAATTATCTCACAACTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-696s21c1
Sequence:CCGGACTTCATGGCTCCTTATATTTCTCGAGAAATATAAGGAGCCATGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.2-1168s1c1
Sequence:CCGGATGTATCAGCTACCGATATTGCTCGAGCAATATCGGTAGCTGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-747s21c1
Sequence:CCGGCCTGCTCGACTTCCAATTTATCTCGAGATAAATTGGAAGTCGAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-1132s21c1
Sequence:CCGGAGAAGTCAAGAAAGCTTATTTCTCGAGAAATAAGCTTTCTTGACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012269.1-2124s1c1
Sequence:CCGGCCTAGTCATTTAAAGAAGGATCTCGAGATCCTTCTTTAAATGACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.1-975s1c1
Sequence:CCGGCTCCCACAGAACATAAGTTTACTCGAGTAAACTTATGTTCTGTGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.1-804s1c1
Sequence:CCGGCCAACAGATCAGTGTTTGATACTCGAGTATCAAACACTGATCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012269
HYAL4 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-2071s21c1
Sequence:CCGGGCATTCAGTTGTGAGATAATTCTCGAGAATTATCTCACAACTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-696s21c1
Sequence:CCGGACTTCATGGCTCCTTATATTTCTCGAGAAATATAAGGAGCCATGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.2-1168s1c1
Sequence:CCGGATGTATCAGCTACCGATATTGCTCGAGCAATATCGGTAGCTGATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-747s21c1
Sequence:CCGGCCTGCTCGACTTCCAATTTATCTCGAGATAAATTGGAAGTCGAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012269.2-1132s21c1
Sequence:CCGGAGAAGTCAAGAAAGCTTATTTCTCGAGAAATAAGCTTTCTTGACTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012269.1-2124s1c1
Sequence:CCGGCCTAGTCATTTAAAGAAGGATCTCGAGATCCTTCTTTAAATGACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.1-975s1c1
Sequence:CCGGCTCCCACAGAACATAAGTTTACTCGAGTAAACTTATGTTCTGTGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012269.1-804s1c1
Sequence:CCGGCCAACAGATCAGTGTTTGATACTCGAGTATCAAACACTGATCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029848
HYAL4 MISSION shRNA Bacterial Glycerol Stock
hyaluronoglucosaminidase 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-491s21c1
Sequence:CCGGGCCAACAGATTGGGATATTACCTCGAGGTAATATCCCAATCTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-1347s21c1
Sequence:CCGGGTCGTCACCTTTGCAAGAATACTCGAGTATTCTTGCAAAGGTGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-810s21c1
Sequence:CCGGTCATGGAGGAAACTATCAAATCTCGAGATTTGATAGTTTCCTCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029848.1-1752s21c1
Sequence:CCGGAGGCCTTATAAATCAACATATCTCGAGATATGTTGATTTATAAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029848
HYAL4 MISSION shRNA shRNA Plasmid DNA
hyaluronoglucosaminidase 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-491s21c1
Sequence:CCGGGCCAACAGATTGGGATATTACCTCGAGGTAATATCCCAATCTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-1347s21c1
Sequence:CCGGGTCGTCACCTTTGCAAGAATACTCGAGTATTCTTGCAAAGGTGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-810s21c1
Sequence:CCGGTCATGGAGGAAACTATCAAATCTCGAGATTTGATAGTTTCCTCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029848.1-1752s21c1
Sequence:CCGGAGGCCTTATAAATCAACATATCTCGAGATATGTTGATTTATAAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029848
HYAL4 MISSION shRNA Lentiviral Transduction Particles
hyaluronoglucosaminidase 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-491s21c1
Sequence:CCGGGCCAACAGATTGGGATATTACCTCGAGGTAATATCCCAATCTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-1347s21c1
Sequence:CCGGGTCGTCACCTTTGCAAGAATACTCGAGTATTCTTGCAAAGGTGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029848.1-810s21c1
Sequence:CCGGTCATGGAGGAAACTATCAAATCTCGAGATTTGATAGTTTCCTCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029848.1-1752s21c1
Sequence:CCGGAGGCCTTATAAATCAACATATCTCGAGATATGTTGATTTATAAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)