EMAIL THIS PAGE TO A FRIEND

HYDIN

HYDIN, axonemal central pair apparatus protein

89 Gene Product Result for
Synonyms: CILD5 HYDIN1 HYDIN2 PPP1R31
Gene ID:
Human(54768) Summary: This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
Mouse(244653) HYDIN, axonemal central pair apparatus protein
Rat(292017) Hydin, axonemal central pair apparatus protein
Zebrafish(557988) HYDIN, axonemal central pair apparatus protein
cow(504406) HYDIN, axonemal central pair apparatus protein
Horse(100068498) HYDIN, axonemal central pair apparatus protein
chicken(427538) HYDIN, axonemal central pair apparatus protein
dog(100683062) HYDIN, axonemal central pair apparatus protein
sheep(101115477) HYDIN, axonemal central pair apparatus protein
domestic guinea pig(100718497) HYDIN, axonemal central pair apparatus protein
naked mole-rat(101696339) HYDIN, axonemal central pair apparatus protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059041 MISSION® esiRNA esiRNA human HYDIN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017558 Rosetta Predictions human pricing
NM_032821 Rosetta Predictions human pricing
XM_001077360 Rosetta Predictions rat pricing
XM_226468 Rosetta Predictions rat pricing
NM_172916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350203 predicted 1081
2 SASI_Hs01_00212121 predicted 2754
3 SASI_Hs01_00212123 predicted 851
4 SASI_Hs02_00350204 predicted 1868
5 SASI_Hs01_00212124 predicted 1070
6 SASI_Hs01_00212125 predicted 1373
7 SASI_Hs02_00350205 predicted 2557
8 SASI_Hs01_00212126 predicted 463
9 SASI_Hs01_00212128 predicted 1410
10 SASI_Hs01_00212129 predicted 502
11 SASI_Hs01_00212122 predicted 2456
12 SASI_Hs01_00212127 predicted 3130
13 SASI_Hs01_00212130 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360401 predicted 1079
2 SASI_Hs02_00360402 predicted 2758
3 SASI_Hs02_00360403 predicted 858
4 SASI_Hs02_00360404 predicted 1874
5 SASI_Hs02_00360405 predicted 1071
6 SASI_Hs02_00360406 predicted 1375
7 SASI_Hs02_00360407 predicted 2562
8 SASI_Hs02_00360408 predicted 470
9 SASI_Hs02_00360409 predicted 1421
10 SASI_Hs02_00360410 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356780 predicted 3058
2 SASI_Rn02_00356781 predicted 3946
3 SASI_Rn02_00356782 predicted 8879
4 SASI_Rn02_00356783 predicted 2787
5 SASI_Rn02_00356784 predicted 8973
6 SASI_Rn02_00356785 predicted 8097
7 SASI_Rn02_00356786 predicted 11033
8 SASI_Rn02_00356787 predicted 6763
9 SASI_Rn02_00356788 predicted 14368
10 SASI_Rn02_00356789 predicted 11869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383595 predicted 3061
2 SASI_Rn02_00383596 predicted 3943
3 SASI_Rn02_00383597 predicted 8879
4 SASI_Rn02_00383598 predicted 2795
5 SASI_Rn02_00383599 predicted 8984
6 SASI_Rn02_00383600 predicted 8106
7 SASI_Rn02_00383601 predicted 10009
8 SASI_Rn02_00383602 predicted 1185
9 SASI_Rn02_00383603 predicted 6768
10 SASI_Rn02_00383604 predicted 14361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149307 predicted 1921
2 SASI_Mm01_00149308 predicted 5329
3 SASI_Mm01_00149309 predicted 8854
4 SASI_Mm01_00149310 predicted 3455
5 SASI_Mm01_00149311 predicted 7503
6 SASI_Mm01_00149312 predicted 12711
7 SASI_Mm01_00149313 predicted 8458
8 SASI_Mm01_00149314 predicted 1224
9 SASI_Mm01_00149315 predicted 9091
10 SASI_Mm01_00149316 predicted 4587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017558
HYDIN MISSION shRNA Bacterial Glycerol Stock
HYDIN, axonemal central pair apparatus protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-2086s1c1
Sequence:CCGGGCTGCTATCAGGGTGACATTACTCGAGTAATGTCACCCTGATAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-790s1c1
Sequence:CCGGGTACGAAACATTGGCAACAAACTCGAGTTTGTTGCCAATGTTTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-2739s1c1
Sequence:CCGGCCTGAATGACACACTGACATTCTCGAGAATGTCAGTGTGTCATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-2896s1c1
Sequence:CCGGGATACCCACTATTACCACTTTCTCGAGAAAGTGGTAATAGTGGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017558.2-3456s1c1
Sequence:CCGGGCCAAAGCAAATTCTCCTATTCTCGAGAATAGGAGAATTTGCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-1555s1c1
Sequence:CCGGGCACATTGTTATGAGGCGATACTCGAGTATCGCCTCATAACAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-3124s1c1
Sequence:CCGGGCAATTGATGTGATACTCGAACTCGAGTTCGAGTATCACATCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-1093s1c1
Sequence:CCGGCGCAGTAATATCATTGCCCATCTCGAGATGGGCAATGATATTACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-337s1c1
Sequence:CCGGCCACAGATCATCGAACTCTTACTCGAGTAAGAGTTCGATGATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017558
HYDIN MISSION shRNA shRNA Plasmid DNA
HYDIN, axonemal central pair apparatus protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-2086s1c1
Sequence:CCGGGCTGCTATCAGGGTGACATTACTCGAGTAATGTCACCCTGATAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-790s1c1
Sequence:CCGGGTACGAAACATTGGCAACAAACTCGAGTTTGTTGCCAATGTTTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-2739s1c1
Sequence:CCGGCCTGAATGACACACTGACATTCTCGAGAATGTCAGTGTGTCATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-2896s1c1
Sequence:CCGGGATACCCACTATTACCACTTTCTCGAGAAAGTGGTAATAGTGGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017558.2-3456s1c1
Sequence:CCGGGCCAAAGCAAATTCTCCTATTCTCGAGAATAGGAGAATTTGCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-1555s1c1
Sequence:CCGGGCACATTGTTATGAGGCGATACTCGAGTATCGCCTCATAACAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-3124s1c1
Sequence:CCGGGCAATTGATGTGATACTCGAACTCGAGTTCGAGTATCACATCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-1093s1c1
Sequence:CCGGCGCAGTAATATCATTGCCCATCTCGAGATGGGCAATGATATTACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-337s1c1
Sequence:CCGGCCACAGATCATCGAACTCTTACTCGAGTAAGAGTTCGATGATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017558
HYDIN MISSION shRNA Lentiviral Transduction Particles
HYDIN, axonemal central pair apparatus protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-2086s1c1
Sequence:CCGGGCTGCTATCAGGGTGACATTACTCGAGTAATGTCACCCTGATAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-790s1c1
Sequence:CCGGGTACGAAACATTGGCAACAAACTCGAGTTTGTTGCCAATGTTTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-2739s1c1
Sequence:CCGGCCTGAATGACACACTGACATTCTCGAGAATGTCAGTGTGTCATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-2896s1c1
Sequence:CCGGGATACCCACTATTACCACTTTCTCGAGAAAGTGGTAATAGTGGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017558.2-3456s1c1
Sequence:CCGGGCCAAAGCAAATTCTCCTATTCTCGAGAATAGGAGAATTTGCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-1555s1c1
Sequence:CCGGGCACATTGTTATGAGGCGATACTCGAGTATCGCCTCATAACAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017558.2-3124s1c1
Sequence:CCGGGCAATTGATGTGATACTCGAACTCGAGTTCGAGTATCACATCAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-1093s1c1
Sequence:CCGGCGCAGTAATATCATTGCCCATCTCGAGATGGGCAATGATATTACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017558.2-337s1c1
Sequence:CCGGCCACAGATCATCGAACTCTTACTCGAGTAAGAGTTCGATGATCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172916
HYDIN MISSION shRNA Bacterial Glycerol Stock
HYDIN, axonemal central pair apparatus protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-1933s1c1
Sequence:CCGGGCTGTGTAATTGGACCTACATCTCGAGATGTAGGTCCAATTACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-7170s1c1
Sequence:CCGGGCAGAAGAGAAAGTTGCATTTCTCGAGAAATGCAACTTTCTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-4913s1c1
Sequence:CCGGGCGACTCATAGTCCAAGACTACTCGAGTAGTCTTGGACTATGAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-5940s1c1
Sequence:CCGGCCAGAAGTCTATGATTACTTTCTCGAGAAAGTAATCATAGACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-13662s1c1
Sequence:CCGGCCTAAAGAAGTCTGTAAACTACTCGAGTAGTTTACAGACTTCTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-6436s1c1
Sequence:CCGGCCATCGTCTTAGAAGCCCTATCTCGAGATAGGGCTTCTAAGACGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-13307s1c1
Sequence:CCGGCTTCAACGTGGACGTGATAAACTCGAGTTTATCACGTCCACGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172916
HYDIN MISSION shRNA shRNA Plasmid DNA
HYDIN, axonemal central pair apparatus protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-1933s1c1
Sequence:CCGGGCTGTGTAATTGGACCTACATCTCGAGATGTAGGTCCAATTACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-7170s1c1
Sequence:CCGGGCAGAAGAGAAAGTTGCATTTCTCGAGAAATGCAACTTTCTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-4913s1c1
Sequence:CCGGGCGACTCATAGTCCAAGACTACTCGAGTAGTCTTGGACTATGAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-5940s1c1
Sequence:CCGGCCAGAAGTCTATGATTACTTTCTCGAGAAAGTAATCATAGACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-13662s1c1
Sequence:CCGGCCTAAAGAAGTCTGTAAACTACTCGAGTAGTTTACAGACTTCTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-6436s1c1
Sequence:CCGGCCATCGTCTTAGAAGCCCTATCTCGAGATAGGGCTTCTAAGACGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-13307s1c1
Sequence:CCGGCTTCAACGTGGACGTGATAAACTCGAGTTTATCACGTCCACGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172916
HYDIN MISSION shRNA Lentiviral Transduction Particles
HYDIN, axonemal central pair apparatus protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-1933s1c1
Sequence:CCGGGCTGTGTAATTGGACCTACATCTCGAGATGTAGGTCCAATTACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-7170s1c1
Sequence:CCGGGCAGAAGAGAAAGTTGCATTTCTCGAGAAATGCAACTTTCTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-4913s1c1
Sequence:CCGGGCGACTCATAGTCCAAGACTACTCGAGTAGTCTTGGACTATGAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-5940s1c1
Sequence:CCGGCCAGAAGTCTATGATTACTTTCTCGAGAAAGTAATCATAGACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-13662s1c1
Sequence:CCGGCCTAAAGAAGTCTGTAAACTACTCGAGTAGTTTACAGACTTCTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172916.2-6436s1c1
Sequence:CCGGCCATCGTCTTAGAAGCCCTATCTCGAGATAGGGCTTCTAAGACGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172916.2-13307s1c1
Sequence:CCGGCTTCAACGTGGACGTGATAAACTCGAGTTTATCACGTCCACGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)