EMAIL THIS PAGE TO A FRIEND

HYI

hydroxypyruvate isomerase (putative)

69 Gene Product Result for
Synonyms: HT036
Gene ID:
Human(81888) Summary: This gene encodes a putative hydroxypyruvate isomerase, which likely catalyzes the conversion of hydroxypyruvate to 2-hydroxy-3-oxopropanoate, and may be involved in carbohydrate transport and metabolism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(68180) hydroxypyruvate isomerase homolog (E. coli)
Rat(500536) hydroxypyruvate isomerase
Zebrafish(393305) hydroxypyruvate isomerase
dog(482531) hydroxypyruvate isomerase (putative)
cow(515954) hydroxypyruvate isomerase (putative)
domestic cat(101098729) hydroxypyruvate isomerase (putative)
chicken(424567) hydroxypyruvate isomerase (putative)
sheep(101107657) hydroxypyruvate isomerase (putative)
domestic guinea pig(100719832) hydroxypyruvate isomerase (putative)
naked mole-rat(101709630) hydroxypyruvate isomerase (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031207 Rosetta Predictions human pricing
XM_575897 Rosetta Predictions rat pricing
XR_008803 Rosetta Predictions rat pricing
NM_026601 Rosetta Predictions mouse pricing
NR_003946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094600 predicted 606
2 SASI_Hs01_00094601 predicted 684
3 SASI_Hs01_00094602 predicted 313
4 SASI_Hs01_00094603 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136757 predicted 151
2 SASI_Rn01_00136758 predicted 247
3 SASI_Rn01_00136759 predicted 288
4 SASI_Rn01_00136760 predicted 155
5 SASI_Rn01_00136761 predicted 253
6 SASI_Rn01_00136762 predicted 299
7 SASI_Rn01_00136763 predicted 35
8 SASI_Rn01_00136764 predicted 77
9 SASI_Rn01_00136765 predicted 30
10 SASI_Rn01_00136766 predicted 164
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154520 predicted 566
2 SASI_Rn01_00154521 predicted 430
3 SASI_Rn01_00154522 predicted 524
4 SASI_Rn01_00154523 predicted 616
5 SASI_Rn02_00417953 predicted 429
6 SASI_Rn02_00417954 predicted 530
7 SASI_Rn01_00154526 predicted 311
8 SASI_Rn01_00154527 predicted 391
9 SASI_Rn01_00154528 predicted 669
10 SASI_Rn02_00417955 predicted 447
11 SASI_Rn01_00154524 predicted 411
12 SASI_Rn01_00154525 predicted 678
13 SASI_Rn01_00154529 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134210 predicted 582
2 SASI_Mm02_00330561 predicted 629
3 SASI_Mm01_00134211 predicted 336
4 SASI_Mm01_00134212 predicted 544
5 SASI_Mm01_00134214 predicted 570
6 SASI_Mm02_00330562 predicted 470
7 SASI_Mm01_00134216 predicted 334
8 SASI_Mm02_00330563 predicted 460
9 SASI_Mm01_00134217 predicted 555
10 SASI_Mm01_00134218 predicted 593
11 SASI_Mm01_00134213 predicted 626
12 SASI_Mm01_00134215 predicted 714
13 SASI_Mm01_00134219 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353906 predicted 472
2 SASI_Mm02_00353907 predicted 515
3 SASI_Mm02_00353908 predicted 434
4 SASI_Mm02_00353909 predicted 456
5 SASI_Mm02_00353910 predicted 222
6 SASI_Mm02_00353911 predicted 354
7 SASI_Mm02_00353912 predicted 354
8 SASI_Mm02_00353913 predicted 451
9 SASI_Mm02_00353914 predicted 221
10 SASI_Mm02_00353915 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031207
VALIDATED
HYI MISSION shRNA Bacterial Glycerol Stock
hydroxypyruvate isomerase (putative)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-781s21c1
Sequence:CCGGTGGAAGATGAAGGCTACAAAGCTCGAGCTTTGTAGCCTTCATCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-614s21c1
Sequence:CCGGCCAATTACAAATGGACATATTCTCGAGAATATGTCCATTTGTAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-662s21c1
Sequence:CCGGGACAGGAAACATCCGGGAGTTCTCGAGAACTCCCGGATGTTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-415s21c1
Sequence:CCGGGAGCTGATCGAATAGCAGTCACTCGAGTGACTGCTATTCGATCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-629s1c1
Sequence:CCGGCATATTCCACTGGCAGATCATCTCGAGATGATCTGCCAGTGGAATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-583s1c1
Sequence:CCGGCCATCTTACAGAAGGTAGGAACTCGAGTTCCTACCTTCTGTAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-424s1c1
Sequence:CCGGGAATAGCAGTCAAGGCTGAGACTCGAGTCTCAGCCTTGACTGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-847s1c1
Sequence:CCGGGCTTGAGTTGGCTACGTTCATCTCGAGATGAACGTAGCCAACTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-420s1c1
Sequence:CCGGGATCGAATAGCAGTCAAGGCTCTCGAGAGCCTTGACTGCTATTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031207.2-582s1c1
Sequence:CCGGGCCATCTTACAGAAGGTAGGACTCGAGTCCTACCTTCTGTAAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-579s1c1
Sequence:CCGGGCAGCCATCTTACAGAAGGTACTCGAGTACCTTCTGTAAGATGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-415s1c1
Sequence:CCGGGAGCTGATCGAATAGCAGTCACTCGAGTGACTGCTATTCGATCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031207
VALIDATED
HYI MISSION shRNA shRNA Plasmid DNA
hydroxypyruvate isomerase (putative)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-781s21c1
Sequence:CCGGTGGAAGATGAAGGCTACAAAGCTCGAGCTTTGTAGCCTTCATCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-614s21c1
Sequence:CCGGCCAATTACAAATGGACATATTCTCGAGAATATGTCCATTTGTAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-662s21c1
Sequence:CCGGGACAGGAAACATCCGGGAGTTCTCGAGAACTCCCGGATGTTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-415s21c1
Sequence:CCGGGAGCTGATCGAATAGCAGTCACTCGAGTGACTGCTATTCGATCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-629s1c1
Sequence:CCGGCATATTCCACTGGCAGATCATCTCGAGATGATCTGCCAGTGGAATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-583s1c1
Sequence:CCGGCCATCTTACAGAAGGTAGGAACTCGAGTTCCTACCTTCTGTAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-424s1c1
Sequence:CCGGGAATAGCAGTCAAGGCTGAGACTCGAGTCTCAGCCTTGACTGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-847s1c1
Sequence:CCGGGCTTGAGTTGGCTACGTTCATCTCGAGATGAACGTAGCCAACTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-420s1c1
Sequence:CCGGGATCGAATAGCAGTCAAGGCTCTCGAGAGCCTTGACTGCTATTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031207.2-582s1c1
Sequence:CCGGGCCATCTTACAGAAGGTAGGACTCGAGTCCTACCTTCTGTAAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-579s1c1
Sequence:CCGGGCAGCCATCTTACAGAAGGTACTCGAGTACCTTCTGTAAGATGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-415s1c1
Sequence:CCGGGAGCTGATCGAATAGCAGTCACTCGAGTGACTGCTATTCGATCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031207
VALIDATED
HYI MISSION shRNA Lentiviral Transduction Particles
hydroxypyruvate isomerase (putative)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-781s21c1
Sequence:CCGGTGGAAGATGAAGGCTACAAAGCTCGAGCTTTGTAGCCTTCATCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-614s21c1
Sequence:CCGGCCAATTACAAATGGACATATTCTCGAGAATATGTCCATTTGTAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-662s21c1
Sequence:CCGGGACAGGAAACATCCGGGAGTTCTCGAGAACTCCCGGATGTTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031207.2-415s21c1
Sequence:CCGGGAGCTGATCGAATAGCAGTCACTCGAGTGACTGCTATTCGATCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-629s1c1
Sequence:CCGGCATATTCCACTGGCAGATCATCTCGAGATGATCTGCCAGTGGAATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-583s1c1
Sequence:CCGGCCATCTTACAGAAGGTAGGAACTCGAGTTCCTACCTTCTGTAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031207.2-424s1c1
Sequence:CCGGGAATAGCAGTCAAGGCTGAGACTCGAGTCTCAGCCTTGACTGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-847s1c1
Sequence:CCGGGCTTGAGTTGGCTACGTTCATCTCGAGATGAACGTAGCCAACTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-420s1c1
Sequence:CCGGGATCGAATAGCAGTCAAGGCTCTCGAGAGCCTTGACTGCTATTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031207.2-582s1c1
Sequence:CCGGGCCATCTTACAGAAGGTAGGACTCGAGTCCTACCTTCTGTAAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-579s1c1
Sequence:CCGGGCAGCCATCTTACAGAAGGTACTCGAGTACCTTCTGTAAGATGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031207.2-415s1c1
Sequence:CCGGGAGCTGATCGAATAGCAGTCACTCGAGTGACTGCTATTCGATCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026601
HYI MISSION shRNA Bacterial Glycerol Stock
hydroxypyruvate isomerase (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-565s1c1
Sequence:CCGGGCAGTTGCAGATGGACATATTCTCGAGAATATGTCCATCTGCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-590s1c1
Sequence:CCGGTGGCAGATCATGGATGGGAATCTCGAGATTCCCATCCATGATCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-727s1c1
Sequence:CCGGGCTGCTAGAAGATGAGGGCTACTCGAGTAGCCCTCATCTTCTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-580s1c1
Sequence:CCGGCATATTCCACTGGCAGATCATCTCGAGATGATCTGCCAGTGGAATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-744s1c1
Sequence:CCGGGCTACCAAGGATTTGTGGGTTCTCGAGAACCCACAAATCCTTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026601
HYI MISSION shRNA shRNA Plasmid DNA
hydroxypyruvate isomerase (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-565s1c1
Sequence:CCGGGCAGTTGCAGATGGACATATTCTCGAGAATATGTCCATCTGCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-590s1c1
Sequence:CCGGTGGCAGATCATGGATGGGAATCTCGAGATTCCCATCCATGATCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-727s1c1
Sequence:CCGGGCTGCTAGAAGATGAGGGCTACTCGAGTAGCCCTCATCTTCTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-580s1c1
Sequence:CCGGCATATTCCACTGGCAGATCATCTCGAGATGATCTGCCAGTGGAATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-744s1c1
Sequence:CCGGGCTACCAAGGATTTGTGGGTTCTCGAGAACCCACAAATCCTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026601
HYI MISSION shRNA Lentiviral Transduction Particles
hydroxypyruvate isomerase (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-565s1c1
Sequence:CCGGGCAGTTGCAGATGGACATATTCTCGAGAATATGTCCATCTGCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-590s1c1
Sequence:CCGGTGGCAGATCATGGATGGGAATCTCGAGATTCCCATCCATGATCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-727s1c1
Sequence:CCGGGCTGCTAGAAGATGAGGGCTACTCGAGTAGCCCTCATCTTCTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-580s1c1
Sequence:CCGGCATATTCCACTGGCAGATCATCTCGAGATGATCTGCCAGTGGAATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026601.1-744s1c1
Sequence:CCGGGCTACCAAGGATTTGTGGGTTCTCGAGAACCCACAAATCCTTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)