EMAIL THIS PAGE TO A FRIEND

HYKK

hydroxylysine kinase

65 Gene Product Result for
Synonyms: AGPHD1
Species: Human HYKK(123688), Mouse Hykk(235386), Rat Hykk(300723), domestic guinea pig Hykk(100720936), naked mole-rat Hykk(101702212)
Gene ID:
Mouse(235386) hydroxylysine kinase 1
Rat(300723) hydroxylysine kinase
domestic guinea pig(100720936) hydroxylysine kinase
naked mole-rat(101702212) hydroxylysine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026141 MISSION® esiRNA esiRNA targeting mouse C630028N24Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013619 Rosetta Predictions human pricing
NM_001083612 Rosetta Predictions human pricing
NM_001106823 Rosetta Predictions rat pricing
NM_177351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306381 predicted 468
2 SASI_Hs02_00306382 predicted 533
3 SASI_Hs02_00306383 predicted 448
4 SASI_Hs02_00306384 predicted 444
5 SASI_Hs02_00306385 predicted 506
6 SASI_Hs02_00306386 predicted 536
7 SASI_Hs02_00306387 predicted 485
8 SASI_Hs02_00306388 predicted 486
9 SASI_Hs02_00306389 predicted 495
10 SASI_Hs02_00306390 predicted 475
11 SASI_Hs01_00222486 predicted 940
12 SASI_Hs01_00222487 predicted 341
13 SASI_Hs01_00222488 predicted 273
14 SASI_Hs01_00222489 predicted 255
15 SASI_Hs01_00222490 predicted 866
16 SASI_Hs01_00222491 predicted 870
17 SASI_Hs01_00222492 predicted 259
18 SASI_Hs01_00222493 predicted 1115
19 SASI_Hs01_00222494 predicted 894
20 SASI_Hs01_00222495 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317111 predicted 286
2 SASI_Hs02_00317112 predicted 354
3 SASI_Hs02_00317113 predicted 306
4 SASI_Hs02_00317114 predicted 335
5 SASI_Hs02_00317115 predicted 274
6 SASI_Hs02_00317116 predicted 448
7 SASI_Hs02_00317117 predicted 426
8 SASI_Hs02_00317118 predicted 423
9 SASI_Hs02_00317119 predicted 406
10 SASI_Hs02_00317120 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222758 predicted 812
2 SASI_Rn02_00222759 predicted 768
3 SASI_Rn02_00222760 predicted 1226
4 SASI_Rn02_00222761 predicted 1660
5 SASI_Rn02_00222762 predicted 1331
6 SASI_Rn02_00222763 predicted 682
7 SASI_Rn02_00222764 predicted 1277
8 SASI_Rn02_00222765 predicted 729
9 SASI_Rn02_00222766 predicted 1722
10 SASI_Rn02_00222767 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347481 predicted 1358
2 SASI_Mm01_00197131 predicted 651
3 SASI_Mm02_00347482 predicted 781
4 SASI_Mm01_00197133 predicted 1673
5 SASI_Mm02_00347483 predicted 1380
6 SASI_Mm01_00197134 predicted 1473
7 SASI_Mm01_00197135 predicted 740
8 SASI_Mm02_00347484 predicted 951
9 SASI_Mm01_00197136 predicted 1037
10 SASI_Mm01_00197138 predicted 1689
11 SASI_Mm01_00197130 predicted 1083
12 SASI_Mm01_00197132 predicted 1266
13 SASI_Mm01_00197137 predicted 763
14 SASI_Mm01_00197139 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013619
HYKK MISSION shRNA Bacterial Glycerol Stock
hydroxylysine kinase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-174s1c1
Sequence:CCGGGAGTCAGTGTTTGGGTTGAAACTCGAGTTTCAACCCAAACACTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-321s1c1
Sequence:CCGGGACCTGATTGAAGTGCAGAATCTCGAGATTCTGCACTTCAATCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013619.1-792s1c1
Sequence:CCGGCGGGAGAACTTCATCTGGAATCTCGAGATTCCAGATGAAGTTCTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-397s1c1
Sequence:CCGGCTAAAGGAGACAACACAGCTTCTCGAGAAGCTGTGTTGTCTCCTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-138s1c1
Sequence:CCGGCCCACTTTCAGTGAGGAACAACTCGAGTTGTTCCTCACTGAAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-414s1c1
Sequence:CCGGGCTTCTCTCGTGTCTGTAGATCTCGAGATCTACAGACACGAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013619
HYKK MISSION shRNA shRNA Plasmid DNA
hydroxylysine kinase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-174s1c1
Sequence:CCGGGAGTCAGTGTTTGGGTTGAAACTCGAGTTTCAACCCAAACACTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-321s1c1
Sequence:CCGGGACCTGATTGAAGTGCAGAATCTCGAGATTCTGCACTTCAATCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013619.1-792s1c1
Sequence:CCGGCGGGAGAACTTCATCTGGAATCTCGAGATTCCAGATGAAGTTCTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-397s1c1
Sequence:CCGGCTAAAGGAGACAACACAGCTTCTCGAGAAGCTGTGTTGTCTCCTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-138s1c1
Sequence:CCGGCCCACTTTCAGTGAGGAACAACTCGAGTTGTTCCTCACTGAAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-414s1c1
Sequence:CCGGGCTTCTCTCGTGTCTGTAGATCTCGAGATCTACAGACACGAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013619
HYKK MISSION shRNA Lentiviral Transduction Particles
hydroxylysine kinase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-174s1c1
Sequence:CCGGGAGTCAGTGTTTGGGTTGAAACTCGAGTTTCAACCCAAACACTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-321s1c1
Sequence:CCGGGACCTGATTGAAGTGCAGAATCTCGAGATTCTGCACTTCAATCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013619.1-792s1c1
Sequence:CCGGCGGGAGAACTTCATCTGGAATCTCGAGATTCCAGATGAAGTTCTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-397s1c1
Sequence:CCGGCTAAAGGAGACAACACAGCTTCTCGAGAAGCTGTGTTGTCTCCTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-138s1c1
Sequence:CCGGCCCACTTTCAGTGAGGAACAACTCGAGTTGTTCCTCACTGAAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013619.1-414s1c1
Sequence:CCGGGCTTCTCTCGTGTCTGTAGATCTCGAGATCTACAGACACGAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177351
HYKK MISSION shRNA Bacterial Glycerol Stock
hydroxylysine kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-644s21c1
Sequence:CCGGGCACTGGTAGAATCGGTATTTCTCGAGAAATACCGATTCTACCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177351.2-2243s1c1
Sequence:CCGGGCATGAGAACACAAGCCGTTACTCGAGTAACGGCTTGTGTTCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-1372s21c1
Sequence:CCGGGTTTGAAGTGGCAATCGTTATCTCGAGATAACGATTGCCACTTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-998s21c1
Sequence:CCGGATCAGCCACCAGCAATTATATCTCGAGATATAATTGCTGGTGGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177351.4-3831s21c1
Sequence:CCGGTCTAGTCTAAGTGGCTATTTACTCGAGTAAATAGCCACTTAGACTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-1012s1c1
Sequence:CCGGCCACCAGCAATTATATGAAATCTCGAGATTTCATATAATTGCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-766s1c1
Sequence:CCGGCCCAGTTGAATATGTCCTCAACTCGAGTTGAGGACATATTCAACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-653s1c1
Sequence:CCGGGCACTGGTAGAATCGGTATTTCTCGAGAAATACCGATTCTACCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177351.2-1779s1c1
Sequence:CCGGGCACCCACAATGTTCTGGATTCTCGAGAATCCAGAACATTGTGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177351
HYKK MISSION shRNA shRNA Plasmid DNA
hydroxylysine kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-644s21c1
Sequence:CCGGGCACTGGTAGAATCGGTATTTCTCGAGAAATACCGATTCTACCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177351.2-2243s1c1
Sequence:CCGGGCATGAGAACACAAGCCGTTACTCGAGTAACGGCTTGTGTTCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-1372s21c1
Sequence:CCGGGTTTGAAGTGGCAATCGTTATCTCGAGATAACGATTGCCACTTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-998s21c1
Sequence:CCGGATCAGCCACCAGCAATTATATCTCGAGATATAATTGCTGGTGGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177351.4-3831s21c1
Sequence:CCGGTCTAGTCTAAGTGGCTATTTACTCGAGTAAATAGCCACTTAGACTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-1012s1c1
Sequence:CCGGCCACCAGCAATTATATGAAATCTCGAGATTTCATATAATTGCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-766s1c1
Sequence:CCGGCCCAGTTGAATATGTCCTCAACTCGAGTTGAGGACATATTCAACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-653s1c1
Sequence:CCGGGCACTGGTAGAATCGGTATTTCTCGAGAAATACCGATTCTACCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177351.2-1779s1c1
Sequence:CCGGGCACCCACAATGTTCTGGATTCTCGAGAATCCAGAACATTGTGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177351
HYKK MISSION shRNA Lentiviral Transduction Particles
hydroxylysine kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-644s21c1
Sequence:CCGGGCACTGGTAGAATCGGTATTTCTCGAGAAATACCGATTCTACCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177351.2-2243s1c1
Sequence:CCGGGCATGAGAACACAAGCCGTTACTCGAGTAACGGCTTGTGTTCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-1372s21c1
Sequence:CCGGGTTTGAAGTGGCAATCGTTATCTCGAGATAACGATTGCCACTTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177351.4-998s21c1
Sequence:CCGGATCAGCCACCAGCAATTATATCTCGAGATATAATTGCTGGTGGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177351.4-3831s21c1
Sequence:CCGGTCTAGTCTAAGTGGCTATTTACTCGAGTAAATAGCCACTTAGACTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-1012s1c1
Sequence:CCGGCCACCAGCAATTATATGAAATCTCGAGATTTCATATAATTGCTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-766s1c1
Sequence:CCGGCCCAGTTGAATATGTCCTCAACTCGAGTTGAGGACATATTCAACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177351.2-653s1c1
Sequence:CCGGGCACTGGTAGAATCGGTATTTCTCGAGAAATACCGATTCTACCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177351.2-1779s1c1
Sequence:CCGGGCACCCACAATGTTCTGGATTCTCGAGAATCCAGAACATTGTGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)