EMAIL THIS PAGE TO A FRIEND

HYLS1

hydrolethalus syndrome 1

34 Gene Product Result for
Synonyms: HLS
UniProtKB ID: Q96M11, B3KXI8, Q96BX9
Gene ID:
Human(219844) Summary: This gene encodes a protein localized to the cytoplasm. Mutations in this gene are associated with hydrolethalus syndrome. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Mouse(76832) hydrolethalus syndrome 1
Rat(680262) hydrolethalus syndrome 1
chicken(768796) hydrolethalus syndrome 1
cow(538735) hydrolethalus syndrome 1
dog(609650) hydrolethalus syndrome 1
domestic cat(101086747) hydrolethalus syndrome 1
sheep(101112773) hydrolethalus syndrome 1
domestic guinea pig(100717944) hydrolethalus syndrome 1
naked mole-rat(101709347) hydrolethalus syndrome 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145014 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145014 Rosetta Predictions human pricing
XM_001056376 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231540 predicted 1507
2 SASI_Hs01_00231541 predicted 870
3 SASI_Hs01_00231542 predicted 929
4 SASI_Hs02_00364863 predicted 1321
5 SASI_Hs01_00231543 predicted 668
6 SASI_Hs01_00231545 predicted 1507
7 SASI_Hs01_00231546 predicted 666
8 SASI_Hs01_00231547 predicted 962
9 SASI_Hs02_00364864 predicted 1476
10 SASI_Hs01_00231548 predicted 1294
11 SASI_Hs01_00231544 predicted 960
12 SASI_Hs01_00231549 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283085 predicted 280
2 SASI_Rn02_00283086 predicted 320
3 SASI_Rn02_00283087 predicted 391
4 SASI_Rn02_00283088 predicted 225
5 SASI_Rn02_00283089 predicted 367
6 SASI_Rn02_00283090 predicted 226
7 SASI_Rn02_00283091 predicted 472
8 SASI_Rn02_00283092 predicted 215
9 SASI_Rn02_00283093 predicted 356
10 SASI_Rn02_00283094 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145014
HYLS1 MISSION shRNA Bacterial Glycerol Stock
hydrolethalus syndrome 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145014.2-1464s21c1
Sequence:CCGGTTGAGATAACCTAGCTCTTTACTCGAGTAAAGAGCTAGGTTATCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145014.2-1198s21c1
Sequence:CCGGGACTGGGACTCAATACGTTTACTCGAGTAAACGTATTGAGTCCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145014.2-1076s21c1
Sequence:CCGGCTTACGAACAAGACCTGATTGCTCGAGCAATCAGGTCTTGTTCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145014.2-1622s21c1
Sequence:CCGGATCCAGCAATTGCAAGATAAACTCGAGTTTATCTTGCAATTGCTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-874s1c1
Sequence:CCGGCGATTATCAGTGAATCAGAATCTCGAGATTCTGATTCACTGATAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145014.1-1587s1c1
Sequence:CCGGCATTGGTATCAGATGATACTTCTCGAGAAGTATCATCTGATACCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-1290s1c1
Sequence:CCGGCAATCCAAACCTCAGCATATACTCGAGTATATGCTGAGGTTTGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-1288s1c1
Sequence:CCGGCCCAATCCAAACCTCAGCATACTCGAGTATGCTGAGGTTTGGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-663s1c1
Sequence:CCGGGCCCAATCTATCCAATATGATCTCGAGATCATATTGGATAGATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145014
HYLS1 MISSION shRNA shRNA Plasmid DNA
hydrolethalus syndrome 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145014.2-1464s21c1
Sequence:CCGGTTGAGATAACCTAGCTCTTTACTCGAGTAAAGAGCTAGGTTATCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145014.2-1198s21c1
Sequence:CCGGGACTGGGACTCAATACGTTTACTCGAGTAAACGTATTGAGTCCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145014.2-1076s21c1
Sequence:CCGGCTTACGAACAAGACCTGATTGCTCGAGCAATCAGGTCTTGTTCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145014.2-1622s21c1
Sequence:CCGGATCCAGCAATTGCAAGATAAACTCGAGTTTATCTTGCAATTGCTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-874s1c1
Sequence:CCGGCGATTATCAGTGAATCAGAATCTCGAGATTCTGATTCACTGATAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145014.1-1587s1c1
Sequence:CCGGCATTGGTATCAGATGATACTTCTCGAGAAGTATCATCTGATACCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-1290s1c1
Sequence:CCGGCAATCCAAACCTCAGCATATACTCGAGTATATGCTGAGGTTTGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-1288s1c1
Sequence:CCGGCCCAATCCAAACCTCAGCATACTCGAGTATGCTGAGGTTTGGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-663s1c1
Sequence:CCGGGCCCAATCTATCCAATATGATCTCGAGATCATATTGGATAGATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145014
HYLS1 MISSION shRNA Lentiviral Transduction Particles
hydrolethalus syndrome 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145014.2-1464s21c1
Sequence:CCGGTTGAGATAACCTAGCTCTTTACTCGAGTAAAGAGCTAGGTTATCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145014.2-1198s21c1
Sequence:CCGGGACTGGGACTCAATACGTTTACTCGAGTAAACGTATTGAGTCCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145014.2-1076s21c1
Sequence:CCGGCTTACGAACAAGACCTGATTGCTCGAGCAATCAGGTCTTGTTCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145014.2-1622s21c1
Sequence:CCGGATCCAGCAATTGCAAGATAAACTCGAGTTTATCTTGCAATTGCTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-874s1c1
Sequence:CCGGCGATTATCAGTGAATCAGAATCTCGAGATTCTGATTCACTGATAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145014.1-1587s1c1
Sequence:CCGGCATTGGTATCAGATGATACTTCTCGAGAAGTATCATCTGATACCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-1290s1c1
Sequence:CCGGCAATCCAAACCTCAGCATATACTCGAGTATATGCTGAGGTTTGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-1288s1c1
Sequence:CCGGCCCAATCCAAACCTCAGCATACTCGAGTATGCTGAGGTTTGGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145014.1-663s1c1
Sequence:CCGGGCCCAATCTATCCAATATGATCTCGAGATCATATTGGATAGATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)