EMAIL THIS PAGE TO A FRIEND

HYOU1

hypoxia up-regulated 1

113 Gene Product Result for
Synonyms: GRP-170 Grp170 HSP12A ORP-150 ORP150
UniProtKB ID: Q9Y4L1, A8C1Z0, Q2I204, Q53H25
Gene ID:
Human(10525) Summary: The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. [provided by RefSeq, Oct 2008]
Mouse(12282) hypoxia up-regulated 1
Rat(192235) hypoxia up-regulated 1
Zebrafish(327133) hypoxia up-regulated 1
cow(282295) hypoxia up-regulated 1
Horse(100071323) hypoxia up-regulated 1
domestic cat(101094621) hypoxia up-regulated 1
dog(479410) hypoxia up-regulated 1
chicken(428251) hypoxia up-regulated 1
sheep(101105848) hypoxia up-regulated 1
domestic guinea pig(100721624) hypoxia up-regulated 1
naked mole-rat(101698405) hypoxia up-regulated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0902 AQUA Peptide LYQPEYQEVSTEEQ[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006389 Rosetta Predictions human pricing
NM_001034028 Rosetta Predictions rat pricing
NM_138867 Rosetta Predictions rat pricing
NM_021395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037719 predicted 1490
2 SASI_Hs01_00037720 predicted 444
3 SASI_Hs01_00037721 predicted 1630
4 SASI_Hs01_00037722 predicted 3049
5 SASI_Hs01_00037723 predicted 1769
6 SASI_Hs01_00037724 predicted 282
7 SASI_Hs01_00037725 predicted 455
8 SASI_Hs01_00037726 predicted 456
9 SASI_Hs01_00037727 predicted 692
10 SASI_Hs01_00037728 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090148 predicted 1624
2 SASI_Rn01_00090149 predicted 1827
3 SASI_Rn01_00090150 predicted 1654
4 SASI_Rn01_00090151 predicted 543
5 SASI_Rn01_00090152 predicted 387
6 SASI_Rn01_00090153 predicted 1638
7 SASI_Rn01_00090154 predicted 1766
8 SASI_Rn01_00090155 predicted 1574
9 SASI_Rn02_00203908 predicted 2570
10 SASI_Rn02_00203909 predicted 2289
11 SASI_Rn01_00090147 predicted 286
12 SASI_Rn01_00090156 predicted 2610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052721 predicted 1785
2 SASI_Rn01_00052722 predicted 1980
3 SASI_Rn01_00052723 predicted 1808
4 SASI_Rn01_00052724 predicted 701
5 SASI_Rn01_00052725 predicted 538
6 SASI_Rn01_00052726 predicted 1792
7 SASI_Rn01_00052727 predicted 1917
8 SASI_Rn01_00052728 predicted 1728
9 SASI_Rn02_00268278 predicted 2720
10 SASI_Rn02_00268279 predicted 2435
11 SASI_Rn01_00052720 predicted 441
12 SASI_Rn01_00052729 predicted 2768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032223 predicted 2674
2 SASI_Mm01_00032225 predicted 1664
3 SASI_Mm01_00032227 predicted 1788
4 SASI_Mm02_00325997 predicted 1181
5 SASI_Mm01_00032229 predicted 1289
6 SASI_Mm02_00325998 predicted 1680
7 SASI_Mm01_00032230 predicted 2629
8 SASI_Mm01_00032231 predicted 428
9 SASI_Mm01_00032232 predicted 1820
10 SASI_Mm02_00325999 predicted 202
11 SASI_Mm01_00032224 predicted 1044
12 SASI_Mm01_00032226 predicted 1461
13 SASI_Mm01_00032228 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021395
HYOU1 MISSION shRNA Bacterial Glycerol Stock
hypoxia up-regulated 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021395.2-3275s1c1
Sequence:CCGGCCTGTGGGTAAGTGAGAGAATCTCGAGATTCTCTCACTTACCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-2992s1c1
Sequence:CCGGCGGCCTTCAAAGAACGATGAACTCGAGTTCATCGTTCTTTGAAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-379s1c1
Sequence:CCGGCCAGAACATGAGCTAATTGTTCTCGAGAACAATTAGCTCATGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-1040s1c1
Sequence:CCGGCCAAAGTAACTCGGGTGGAATCTCGAGATTCCACCCGAGTTACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-1531s1c1
Sequence:CCGGCCTGAGGATCTTCGGGTATTTCTCGAGAAATACCCGAAGATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021395.4-1773s21c1
Sequence:CCGGGACAGGGTGGAGTCCGTATTTCTCGAGAAATACGGACTCCACCCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021395
HYOU1 MISSION shRNA shRNA Plasmid DNA
hypoxia up-regulated 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021395.2-3275s1c1
Sequence:CCGGCCTGTGGGTAAGTGAGAGAATCTCGAGATTCTCTCACTTACCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-2992s1c1
Sequence:CCGGCGGCCTTCAAAGAACGATGAACTCGAGTTCATCGTTCTTTGAAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-379s1c1
Sequence:CCGGCCAGAACATGAGCTAATTGTTCTCGAGAACAATTAGCTCATGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-1040s1c1
Sequence:CCGGCCAAAGTAACTCGGGTGGAATCTCGAGATTCCACCCGAGTTACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-1531s1c1
Sequence:CCGGCCTGAGGATCTTCGGGTATTTCTCGAGAAATACCCGAAGATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021395.4-1773s21c1
Sequence:CCGGGACAGGGTGGAGTCCGTATTTCTCGAGAAATACGGACTCCACCCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021395
HYOU1 MISSION shRNA Lentiviral Transduction Particles
hypoxia up-regulated 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021395.2-3275s1c1
Sequence:CCGGCCTGTGGGTAAGTGAGAGAATCTCGAGATTCTCTCACTTACCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-2992s1c1
Sequence:CCGGCGGCCTTCAAAGAACGATGAACTCGAGTTCATCGTTCTTTGAAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-379s1c1
Sequence:CCGGCCAGAACATGAGCTAATTGTTCTCGAGAACAATTAGCTCATGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-1040s1c1
Sequence:CCGGCCAAAGTAACTCGGGTGGAATCTCGAGATTCCACCCGAGTTACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021395.2-1531s1c1
Sequence:CCGGCCTGAGGATCTTCGGGTATTTCTCGAGAAATACCCGAAGATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021395.4-1773s21c1
Sequence:CCGGGACAGGGTGGAGTCCGTATTTCTCGAGAAATACGGACTCCACCCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006389
VALIDATED
HYOU1 MISSION shRNA Bacterial Glycerol Stock
hypoxia up-regulated 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-824s1c1
Sequence:CCGGGCCCAGAATATCATGTTCTATCTCGAGATAGAACATGATATTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-314s1c1
Sequence:CCGGCCCATGGAAATTGTCTTGAATCTCGAGATTCAAGACAATTTCCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-3128s1c1
Sequence:CCGGCCTTTGAAGAACGACGAACTACTCGAGTAGTTCGTCGTTCTTCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-1436s1c1
Sequence:CCGGGCCTTTAAAGTGAAGCCATTTCTCGAGAAATGGCTTCACTTTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006389.2-417s1c1
Sequence:CCGGCGATTAAGAATCCAAAGGCTACTCGAGTAGCCTTTGGATTCTTAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006389
VALIDATED
HYOU1 MISSION shRNA shRNA Plasmid DNA
hypoxia up-regulated 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-824s1c1
Sequence:CCGGGCCCAGAATATCATGTTCTATCTCGAGATAGAACATGATATTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-314s1c1
Sequence:CCGGCCCATGGAAATTGTCTTGAATCTCGAGATTCAAGACAATTTCCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-3128s1c1
Sequence:CCGGCCTTTGAAGAACGACGAACTACTCGAGTAGTTCGTCGTTCTTCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-1436s1c1
Sequence:CCGGGCCTTTAAAGTGAAGCCATTTCTCGAGAAATGGCTTCACTTTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006389.2-417s1c1
Sequence:CCGGCGATTAAGAATCCAAAGGCTACTCGAGTAGCCTTTGGATTCTTAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006389
VALIDATED
HYOU1 MISSION shRNA Lentiviral Transduction Particles
hypoxia up-regulated 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-824s1c1
Sequence:CCGGGCCCAGAATATCATGTTCTATCTCGAGATAGAACATGATATTCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-314s1c1
Sequence:CCGGCCCATGGAAATTGTCTTGAATCTCGAGATTCAAGACAATTTCCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-3128s1c1
Sequence:CCGGCCTTTGAAGAACGACGAACTACTCGAGTAGTTCGTCGTTCTTCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006389.2-1436s1c1
Sequence:CCGGGCCTTTAAAGTGAAGCCATTTCTCGAGAAATGGCTTCACTTTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006389.2-417s1c1
Sequence:CCGGCGATTAAGAATCCAAAGGCTACTCGAGTAGCCTTTGGATTCTTAATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)