EMAIL THIS PAGE TO A FRIEND

HYPK

huntingtin interacting protein K

56 Gene Product Result for
Synonyms: C15orf63
UniProtKB ID: Q9NX55, C9JKJ0, O75408, Q8WUW8, Q9P024
Gene ID:
Mouse(67693) huntingtin interacting protein K
Rat(311359) Huntingtin interacting protein K
sheep(101111231) huntingtin interacting protein K
Domestic Rabbit(100328687) huntingtin interacting protein K
domestic guinea pig(100718702) huntingtin interacting protein K
Zebrafish(100151755) huntingtin interacting protein K
domestic cat(101096321) huntingtin interacting protein K
dog(487528) huntingtin interacting protein K
chicken(770307) huntingtin interacting protein K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016400 Rosetta Predictions human pricing
XM_001080972 Rosetta Predictions rat pricing
XM_230510 Rosetta Predictions rat pricing
NM_026318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349407 predicted 353
2 SASI_Hs01_00193448 predicted 304
3 SASI_Hs02_00349408 predicted 260
4 SASI_Hs01_00193449 predicted 327
5 SASI_Hs02_00349409 predicted 363
6 SASI_Hs02_00349410 predicted 355
7 SASI_Hs01_00193450 predicted 307
8 SASI_Hs01_00193452 predicted 282
9 SASI_Hs02_00349411 predicted 384
10 SASI_Hs01_00193454 predicted 260
11 SASI_Hs01_00193451 predicted 315
12 SASI_Hs01_00193453 predicted 231
13 SASI_Hs01_00193455 predicted 269
14 SASI_Hs01_00193456 predicted 300
15 SASI_Hs01_00193457 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370064 predicted 269
2 SASI_Rn02_00370065 predicted 294
3 SASI_Rn02_00370066 predicted 299
4 SASI_Rn02_00370067 predicted 247
5 SASI_Rn02_00370068 predicted 224
6 SASI_Rn02_00370069 predicted 316
7 SASI_Rn02_00370070 predicted 233
8 SASI_Rn02_00370071 predicted 296
9 SASI_Rn02_00370072 predicted 199
10 SASI_Rn02_00370073 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386296 predicted 220
2 SASI_Rn02_00386297 predicted 248
3 SASI_Rn02_00386298 predicted 245
4 SASI_Rn02_00386299 predicted 199
5 SASI_Rn02_00386300 predicted 270
6 SASI_Rn02_00386301 predicted 249
7 SASI_Rn02_00386302 predicted 242
8 SASI_Rn02_00386303 predicted 223
9 SASI_Rn02_00386304 predicted 220
10 SASI_Rn02_00386305 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046963 predicted 205
2 SASI_Mm01_00046965 predicted 110
3 SASI_Mm01_00046966 predicted 238
4 SASI_Mm01_00046967 predicted 275
5 SASI_Mm01_00046968 predicted 370
6 SASI_Mm01_00046969 predicted 130
7 SASI_Mm01_00046970 predicted 190
8 SASI_Mm01_00046972 predicted 144
9 SASI_Mm02_00330022 predicted 88
10 SASI_Mm02_00330023 predicted 34
11 SASI_Mm01_00046964 predicted 237
12 SASI_Mm01_00046971 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026318
HYPK MISSION shRNA Bacterial Glycerol Stock
huntingtin interacting protein K
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-133s21c1
Sequence:CCGGTAGAGCGGGTTACTGACTATGCTCGAGCATAGTCAGTAACCCGCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026318.1-176s1c1
Sequence:CCGGGTTCGAATCTTGAAACGGCTACTCGAGTAGCCGTTTCAAGATTCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-255s21c1
Sequence:CCGGGAACTGGCGAAGGTCACTATCCTCGAGGATAGTGACCTTCGCCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026318.1-423s1c1
Sequence:CCGGCTGACTGACTGACTGAAATAACTCGAGTTATTTCAGTCAGTCAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026318.2-412s21c1
Sequence:CCGGACATTCTGGACTGACTGACTGCTCGAGCAGTCAGTCAGTCCAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-291s21c1
Sequence:CCGGGAGTTGATAATGACGGAAATGCTCGAGCATTTCCGTCATTATCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-378s21c1
Sequence:CCGGATTGCCCTAACCAACTGATAACTCGAGTTATCAGTTGGTTAGGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026318
HYPK MISSION shRNA shRNA Plasmid DNA
huntingtin interacting protein K
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-133s21c1
Sequence:CCGGTAGAGCGGGTTACTGACTATGCTCGAGCATAGTCAGTAACCCGCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026318.1-176s1c1
Sequence:CCGGGTTCGAATCTTGAAACGGCTACTCGAGTAGCCGTTTCAAGATTCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-255s21c1
Sequence:CCGGGAACTGGCGAAGGTCACTATCCTCGAGGATAGTGACCTTCGCCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026318.1-423s1c1
Sequence:CCGGCTGACTGACTGACTGAAATAACTCGAGTTATTTCAGTCAGTCAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026318.2-412s21c1
Sequence:CCGGACATTCTGGACTGACTGACTGCTCGAGCAGTCAGTCAGTCCAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-291s21c1
Sequence:CCGGGAGTTGATAATGACGGAAATGCTCGAGCATTTCCGTCATTATCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-378s21c1
Sequence:CCGGATTGCCCTAACCAACTGATAACTCGAGTTATCAGTTGGTTAGGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026318
HYPK MISSION shRNA Lentiviral Transduction Particles
huntingtin interacting protein K
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-133s21c1
Sequence:CCGGTAGAGCGGGTTACTGACTATGCTCGAGCATAGTCAGTAACCCGCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026318.1-176s1c1
Sequence:CCGGGTTCGAATCTTGAAACGGCTACTCGAGTAGCCGTTTCAAGATTCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-255s21c1
Sequence:CCGGGAACTGGCGAAGGTCACTATCCTCGAGGATAGTGACCTTCGCCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026318.1-423s1c1
Sequence:CCGGCTGACTGACTGACTGAAATAACTCGAGTTATTTCAGTCAGTCAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026318.2-412s21c1
Sequence:CCGGACATTCTGGACTGACTGACTGCTCGAGCAGTCAGTCAGTCCAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-291s21c1
Sequence:CCGGGAGTTGATAATGACGGAAATGCTCGAGCATTTCCGTCATTATCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026318.2-378s21c1
Sequence:CCGGATTGCCCTAACCAACTGATAACTCGAGTTATCAGTTGGTTAGGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016400
VALIDATED
HYPK MISSION shRNA Bacterial Glycerol Stock
huntingtin interacting protein K
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-464s1c1
Sequence:CCGGGCTAATAATGACTGAGATGGACTCGAGTCCATCTCAGTCATTATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-529s1c1
Sequence:CCGGGCAACGTGGTAGAGGCGCTTACTCGAGTAAGCGCCTCTACCACGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-273s1c1
Sequence:CCGGCCACGGAAACATGACAGCGGTCTCGAGACCGCTGTCATGTTTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016400.2-338s1c1
Sequence:CCGGGATCCAGAGTTCCAATCTGGACTCGAGTCCAGATTGGAACTCTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016400.2-415s1c1
Sequence:CCGGAGCGGGAGAAAGAACTGGCAACTCGAGTTGCCAGTTCTTTCTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016400.2-506s21c1
Sequence:CCGGACGCAGTTTGCGGGAACACATCTCGAGATGTGTTCCCGCAAACTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016400.2-651s21c1
Sequence:CCGGCAAGTAGAGTGTATACTATATCTCGAGATATAGTATACACTCTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016400.2-452s21c1
Sequence:CCGGGGAAGATCTGGAGCTAATAATCTCGAGATTATTAGCTCCAGATCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016400.2-976s21c1
Sequence:CCGGGGCCACCTTGAGTTAGAATTTCTCGAGAAATTCTAACTCAAGGTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016400
VALIDATED
HYPK MISSION shRNA shRNA Plasmid DNA
huntingtin interacting protein K
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-464s1c1
Sequence:CCGGGCTAATAATGACTGAGATGGACTCGAGTCCATCTCAGTCATTATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-529s1c1
Sequence:CCGGGCAACGTGGTAGAGGCGCTTACTCGAGTAAGCGCCTCTACCACGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-273s1c1
Sequence:CCGGCCACGGAAACATGACAGCGGTCTCGAGACCGCTGTCATGTTTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016400.2-338s1c1
Sequence:CCGGGATCCAGAGTTCCAATCTGGACTCGAGTCCAGATTGGAACTCTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016400.2-415s1c1
Sequence:CCGGAGCGGGAGAAAGAACTGGCAACTCGAGTTGCCAGTTCTTTCTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016400.2-506s21c1
Sequence:CCGGACGCAGTTTGCGGGAACACATCTCGAGATGTGTTCCCGCAAACTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016400.2-651s21c1
Sequence:CCGGCAAGTAGAGTGTATACTATATCTCGAGATATAGTATACACTCTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016400.2-452s21c1
Sequence:CCGGGGAAGATCTGGAGCTAATAATCTCGAGATTATTAGCTCCAGATCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016400.2-976s21c1
Sequence:CCGGGGCCACCTTGAGTTAGAATTTCTCGAGAAATTCTAACTCAAGGTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016400
VALIDATED
HYPK MISSION shRNA Lentiviral Transduction Particles
huntingtin interacting protein K
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-464s1c1
Sequence:CCGGGCTAATAATGACTGAGATGGACTCGAGTCCATCTCAGTCATTATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-529s1c1
Sequence:CCGGGCAACGTGGTAGAGGCGCTTACTCGAGTAAGCGCCTCTACCACGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016400.2-273s1c1
Sequence:CCGGCCACGGAAACATGACAGCGGTCTCGAGACCGCTGTCATGTTTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016400.2-338s1c1
Sequence:CCGGGATCCAGAGTTCCAATCTGGACTCGAGTCCAGATTGGAACTCTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016400.2-415s1c1
Sequence:CCGGAGCGGGAGAAAGAACTGGCAACTCGAGTTGCCAGTTCTTTCTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016400.2-506s21c1
Sequence:CCGGACGCAGTTTGCGGGAACACATCTCGAGATGTGTTCCCGCAAACTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016400.2-651s21c1
Sequence:CCGGCAAGTAGAGTGTATACTATATCTCGAGATATAGTATACACTCTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016400.2-452s21c1
Sequence:CCGGGGAAGATCTGGAGCTAATAATCTCGAGATTATTAGCTCCAGATCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016400.2-976s21c1
Sequence:CCGGGGCCACCTTGAGTTAGAATTTCTCGAGAAATTCTAACTCAAGGTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)