EMAIL THIS PAGE TO A FRIEND

IAPP

islet amyloid polypeptide

84 Gene Product Result for
Synonyms: DAP IAP
UniProtKB ID: P10997, Q0ZD87, Q14598
Gene ID:
Human(3375) Summary: Islet, or insulinoma, amyloid polypeptide is commonly found in pancreatic islets of patients suffering diabetes mellitus type II, or harboring an insulinoma. While the association of amylin with the development of type II diabetes has been known for some time, a direct causative role for amylin has been harder to establish. Studies suggest that amylin, like the related beta-amyloid (Abeta) associated with Alzheimer's disease, can induce apoptotic cell-death in particular cultured cells, an effect that may be relevant to the development of type II diabetes. [provided by RefSeq, Apr 2011]
Mouse(15874) islet amyloid polypeptide
Rat(24476) islet amyloid polypeptide
sheep(101120402) islet amyloid polypeptide
Domestic Rabbit(100009489) islet amyloid polypeptide
domestic guinea pig(100135550) islet amyloid polypeptide
naked mole-rat(101702167) islet amyloid polypeptide
chicken(396362) islet amyloid polypeptide
dog(403909) islet amyloid polypeptide
cow(100138011) islet amyloid polypeptide
domestic cat(751513) islet amyloid polypeptide
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000415 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000415 Rosetta Predictions human pricing
NM_012586 Rosetta Predictions rat pricing
NM_010491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183962 predicted 505
2 SASI_Hs01_00183963 predicted 317
3 SASI_Hs01_00183965 predicted 204
4 SASI_Hs01_00183966 predicted 407
5 SASI_Hs01_00183967 predicted 252
6 SASI_Hs01_00183968 predicted 288
7 SASI_Hs01_00183969 predicted 328
8 SASI_Hs02_00302511 predicted 301
9 SASI_Hs01_00183970 predicted 476
10 SASI_Hs01_00183971 predicted 403
11 SASI_Hs01_00183964 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113218 predicted 554
2 SASI_Rn01_00113219 predicted 217
3 SASI_Rn02_00259726 predicted 408
4 SASI_Rn01_00113220 predicted 645
5 SASI_Rn01_00113221 predicted 285
6 SASI_Rn01_00113222 predicted 602
7 SASI_Rn01_00113224 predicted 368
8 SASI_Rn01_00113225 predicted 649
9 SASI_Rn01_00113226 predicted 516
10 SASI_Rn01_00113227 predicted 394
11 SASI_Rn01_00113223 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057973 predicted 229
2 SASI_Mm01_00057975 predicted 363
3 SASI_Mm01_00057976 predicted 293
4 SASI_Mm02_00318731 predicted 365
5 SASI_Mm01_00057977 predicted 396
6 SASI_Mm01_00057978 predicted 394
7 SASI_Mm01_00057979 predicted 352
8 SASI_Mm01_00057980 predicted 357
9 SASI_Mm01_00057981 predicted 301
10 SASI_Mm01_00057982 predicted 290
11 SASI_Mm01_00057974 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010491
IAPP MISSION shRNA Bacterial Glycerol Stock
islet amyloid polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010491.2-259s21c1
Sequence:CCGGTTCGTTCCAGCAACAACCTTGCTCGAGCAAGGTTGTTGCTGGAACGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010491.2-234s21c1
Sequence:CCCGACACAACGCCTGGCAAACTTTCTCGAGAAAGTTTGCCAGGCGTTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010491.2-512s21c1
Sequence:CCGGTGTAAATTCTCATGCTAAGAACTCGAGTTCTTAGCATGAGAATTTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-296s1c1
Sequence:CCGGCAACGTGGGATCGAATACATACTCGAGTATGTATTCGATCCCACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-355s1c1
Sequence:CCGGCCTTGGATTTCTTACTCGTTTCTCGAGAAACGAGTAAGAAATCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-343s1c1
Sequence:CCGGCAAATAGGGAATCCTTGGATTCTCGAGAATCCAAGGATTCCCTATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-188s1c1
Sequence:CCGGCCCTCAGATGGACAAACGGAACTCGAGTTCCGTTTGTCCATCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010491.1-420s1c1
Sequence:CCGGGCTCTGGTGATTTCCTGAATACTCGAGTATTCAGGAAATCACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010491
IAPP MISSION shRNA shRNA Plasmid DNA
islet amyloid polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010491.2-259s21c1
Sequence:CCGGTTCGTTCCAGCAACAACCTTGCTCGAGCAAGGTTGTTGCTGGAACGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010491.2-234s21c1
Sequence:CCCGACACAACGCCTGGCAAACTTTCTCGAGAAAGTTTGCCAGGCGTTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010491.2-512s21c1
Sequence:CCGGTGTAAATTCTCATGCTAAGAACTCGAGTTCTTAGCATGAGAATTTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-296s1c1
Sequence:CCGGCAACGTGGGATCGAATACATACTCGAGTATGTATTCGATCCCACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-355s1c1
Sequence:CCGGCCTTGGATTTCTTACTCGTTTCTCGAGAAACGAGTAAGAAATCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-343s1c1
Sequence:CCGGCAAATAGGGAATCCTTGGATTCTCGAGAATCCAAGGATTCCCTATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-188s1c1
Sequence:CCGGCCCTCAGATGGACAAACGGAACTCGAGTTCCGTTTGTCCATCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010491.1-420s1c1
Sequence:CCGGGCTCTGGTGATTTCCTGAATACTCGAGTATTCAGGAAATCACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010491
IAPP MISSION shRNA Lentiviral Transduction Particles
islet amyloid polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010491.2-259s21c1
Sequence:CCGGTTCGTTCCAGCAACAACCTTGCTCGAGCAAGGTTGTTGCTGGAACGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010491.2-234s21c1
Sequence:CCCGACACAACGCCTGGCAAACTTTCTCGAGAAAGTTTGCCAGGCGTTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010491.2-512s21c1
Sequence:CCGGTGTAAATTCTCATGCTAAGAACTCGAGTTCTTAGCATGAGAATTTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-296s1c1
Sequence:CCGGCAACGTGGGATCGAATACATACTCGAGTATGTATTCGATCCCACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-355s1c1
Sequence:CCGGCCTTGGATTTCTTACTCGTTTCTCGAGAAACGAGTAAGAAATCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-343s1c1
Sequence:CCGGCAAATAGGGAATCCTTGGATTCTCGAGAATCCAAGGATTCCCTATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010491.1-188s1c1
Sequence:CCGGCCCTCAGATGGACAAACGGAACTCGAGTTCCGTTTGTCCATCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010491.1-420s1c1
Sequence:CCGGGCTCTGGTGATTTCCTGAATACTCGAGTATTCAGGAAATCACCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000415
IAPP MISSION shRNA Bacterial Glycerol Stock
islet amyloid polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000415.2-579s21c1
Sequence:CCGGACTAACTAAGGTCCCATAATACTCGAGTATTATGGGACCTTAGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000415.2-421s21c1
Sequence:CCGGAGAGGACAATGTAACTCTATACTCGAGTATAGAGTTACATTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000415.2-457s21c1
Sequence:CCGGTCTAGTGATTTCCTGTATAATCTCGAGATTATACAGGAAATCACTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000415.1-1247s1c1
Sequence:CCGGGCTGGTACTAAGAGGCTATTTCTCGAGAAATAGCCTCTTAGTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-200s1c1
Sequence:CCGGGCTACACCCATTGAAAGTCATCTCGAGATGACTTTCAATGGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-292s1c1
Sequence:CCGGCAGCAACAACTTTGGTGCCATCTCGAGATGGCACCAAAGTTGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-351s1c1
Sequence:CCGGAGAGGAATGCAGTAGAGGTTTCTCGAGAAACCTCTACTGCATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-173s1c1
Sequence:CCGGCTCTCTGTTGCATTGAACCATCTCGAGATGGTTCAATGCAACAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000415
IAPP MISSION shRNA shRNA Plasmid DNA
islet amyloid polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000415.2-579s21c1
Sequence:CCGGACTAACTAAGGTCCCATAATACTCGAGTATTATGGGACCTTAGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000415.2-421s21c1
Sequence:CCGGAGAGGACAATGTAACTCTATACTCGAGTATAGAGTTACATTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000415.2-457s21c1
Sequence:CCGGTCTAGTGATTTCCTGTATAATCTCGAGATTATACAGGAAATCACTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000415.1-1247s1c1
Sequence:CCGGGCTGGTACTAAGAGGCTATTTCTCGAGAAATAGCCTCTTAGTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-200s1c1
Sequence:CCGGGCTACACCCATTGAAAGTCATCTCGAGATGACTTTCAATGGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-292s1c1
Sequence:CCGGCAGCAACAACTTTGGTGCCATCTCGAGATGGCACCAAAGTTGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-351s1c1
Sequence:CCGGAGAGGAATGCAGTAGAGGTTTCTCGAGAAACCTCTACTGCATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-173s1c1
Sequence:CCGGCTCTCTGTTGCATTGAACCATCTCGAGATGGTTCAATGCAACAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000415
IAPP MISSION shRNA Lentiviral Transduction Particles
islet amyloid polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000415.2-579s21c1
Sequence:CCGGACTAACTAAGGTCCCATAATACTCGAGTATTATGGGACCTTAGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000415.2-421s21c1
Sequence:CCGGAGAGGACAATGTAACTCTATACTCGAGTATAGAGTTACATTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000415.2-457s21c1
Sequence:CCGGTCTAGTGATTTCCTGTATAATCTCGAGATTATACAGGAAATCACTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000415.1-1247s1c1
Sequence:CCGGGCTGGTACTAAGAGGCTATTTCTCGAGAAATAGCCTCTTAGTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-200s1c1
Sequence:CCGGGCTACACCCATTGAAAGTCATCTCGAGATGACTTTCAATGGGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-292s1c1
Sequence:CCGGCAGCAACAACTTTGGTGCCATCTCGAGATGGCACCAAAGTTGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-351s1c1
Sequence:CCGGAGAGGAATGCAGTAGAGGTTTCTCGAGAAACCTCTACTGCATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000415.1-173s1c1
Sequence:CCGGCTCTCTGTTGCATTGAACCATCTCGAGATGGTTCAATGCAACAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)