EMAIL THIS PAGE TO A FRIEND

IARS2

isoleucyl-tRNA synthetase 2, mitochondrial

61 Gene Product Result for
Synonyms: ILERS
Gene ID:
Mouse(381314) isoleucine-tRNA synthetase 2, mitochondrial
Rat(364070) isoleucyl-tRNA synthetase 2, mitochondrial
Zebrafish(100001219) isoleucine-tRNA synthetase 2, mitochondrial
chicken(421346) isoleucyl-tRNA synthetase 2, mitochondrial
dog(478963) isoleucyl-tRNA synthetase 2, mitochondrial
domestic cat(101096199) isoleucyl-tRNA synthetase 2, mitochondrial
cow(533057) isoleucyl-tRNA synthetase 2, mitochondrial
Horse(100049915) isoleucyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100716563) isoleucyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101710191) isoleucyl-tRNA synthetase 2, mitochondrial
sheep(101122877) isoleucyl-tRNA synthetase 2, mitochondrial
Domestic Rabbit(100353799) isoleucyl-tRNA synthetase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018060 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018060 Rosetta Predictions human pricing
XM_001065536 Rosetta Predictions rat pricing
XM_344185 Rosetta Predictions rat pricing
NM_198653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113905 predicted 1144
2 SASI_Hs02_00351197 predicted 1536
3 SASI_Hs02_00351198 predicted 2584
4 SASI_Hs02_00351199 predicted 2972
5 SASI_Hs01_00113907 predicted 386
6 SASI_Hs01_00113908 predicted 2691
7 SASI_Hs01_00113909 predicted 2257
8 SASI_Hs01_00113910 predicted 2381
9 SASI_Hs01_00113911 predicted 1507
10 SASI_Hs02_00351200 predicted 1406
11 SASI_Hs01_00113906 predicted 2059
12 SASI_Hs01_00113912 predicted 1492
13 SASI_Hs01_00113913 predicted 670
14 SASI_Hs01_00113914 predicted 2177
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314524 predicted 2359
2 SASI_Rn02_00314525 predicted 1203
3 SASI_Rn02_00314526 predicted 1125
4 SASI_Rn02_00314527 predicted 2393
5 SASI_Rn02_00314528 predicted 3009
6 SASI_Rn02_00314529 predicted 767
7 SASI_Rn02_00314530 predicted 2574
8 SASI_Rn02_00314531 predicted 2052
9 SASI_Rn02_00314532 predicted 1736
10 SASI_Rn02_00314533 predicted 2965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396931 predicted 277
2 SASI_Rn02_00396932 predicted 211
3 SASI_Rn02_00396933 predicted 208
4 SASI_Rn02_00396934 predicted 283
5 SASI_Rn02_00396935 predicted 212
6 SASI_Rn02_00396936 predicted 279
7 SASI_Rn02_00396937 predicted 284
8 SASI_Rn02_00396938 predicted 1132
9 SASI_Rn02_00396939 predicted 304
10 SASI_Rn02_00396940 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047320 predicted 1754
2 SASI_Mm01_00047321 predicted 1624
3 SASI_Mm01_00047322 predicted 3013
4 SASI_Mm01_00047323 predicted 1223
5 SASI_Mm01_00047324 predicted 452
6 SASI_Mm01_00047325 predicted 2987
7 SASI_Mm01_00047326 predicted 2413
8 SASI_Mm01_00047327 predicted 597
9 SASI_Mm01_00047328 predicted 817
10 SASI_Mm01_00047329 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198653
IARS2 MISSION shRNA Bacterial Glycerol Stock
isoleucyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198653.1-3241s1c1
Sequence:CCGGCCAAGGCTTACACAGAAAGTACTCGAGTACTTTCTGTGTAAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-2359s1c1
Sequence:CCGGCGTGAAGAATATGTATGTCATCTCGAGATGACATACATATTCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-1224s1c1
Sequence:CCGGCCGATAAAGTGTCTCCTCTTTCTCGAGAAAGAGGAGACACTTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-784s1c1
Sequence:CCGGGCTGAGAGTATTCTACCAAATCTCGAGATTTGGTAGAATACTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-1223s1c1
Sequence:CCGGCCCGATAAAGTGTCTCCTCTTCTCGAGAAGAGGAGACACTTTATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198653
IARS2 MISSION shRNA shRNA Plasmid DNA
isoleucyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198653.1-3241s1c1
Sequence:CCGGCCAAGGCTTACACAGAAAGTACTCGAGTACTTTCTGTGTAAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-2359s1c1
Sequence:CCGGCGTGAAGAATATGTATGTCATCTCGAGATGACATACATATTCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-1224s1c1
Sequence:CCGGCCGATAAAGTGTCTCCTCTTTCTCGAGAAAGAGGAGACACTTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-784s1c1
Sequence:CCGGGCTGAGAGTATTCTACCAAATCTCGAGATTTGGTAGAATACTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-1223s1c1
Sequence:CCGGCCCGATAAAGTGTCTCCTCTTCTCGAGAAGAGGAGACACTTTATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198653
IARS2 MISSION shRNA Lentiviral Transduction Particles
isoleucyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198653.1-3241s1c1
Sequence:CCGGCCAAGGCTTACACAGAAAGTACTCGAGTACTTTCTGTGTAAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-2359s1c1
Sequence:CCGGCGTGAAGAATATGTATGTCATCTCGAGATGACATACATATTCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-1224s1c1
Sequence:CCGGCCGATAAAGTGTCTCCTCTTTCTCGAGAAAGAGGAGACACTTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-784s1c1
Sequence:CCGGGCTGAGAGTATTCTACCAAATCTCGAGATTTGGTAGAATACTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198653.1-1223s1c1
Sequence:CCGGCCCGATAAAGTGTCTCCTCTTCTCGAGAAGAGGAGACACTTTATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018060
VALIDATED
IARS2 MISSION shRNA Bacterial Glycerol Stock
isoleucyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-2688s1c1
Sequence:CCGGGCAGATGTAATCGAGCTTAAACTCGAGTTTAAGCTCGATTACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-2012s1c1
Sequence:CCGGGCTTAGGAATACACTTCGCTTCTCGAGAAGCGAAGTGTATTCCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018060.2-118s1c1
Sequence:CCGGCAGAACTTTATTCATGGCAAACTCGAGTTTGCCATGAATAAAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-837s1c1
Sequence:CCGGGCAGATAAAGTAGCATCTGTTCTCGAGAACAGATGCTACTTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-549s1c1
Sequence:CCGGCGATCTTACAAACCTGTGTTTCTCGAGAAACACAGGTTTGTAAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-1091s21c1
Sequence:CCGGCTACGTACTGGCGGCAGATAACTCGAGTTATCTGCCGCCAGTACGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-1189s21c1
Sequence:CCGGGTACTTGCAGTCATCCATTAACTCGAGTTAATGGATGACTGCAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-2124s21c1
Sequence:CCGGCATCCTGATGTTGTCGTTAATCTCGAGATTAACGACAACATCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-3190s21c1
Sequence:CCGGGAAGTTTGGATGGATTATTTACTCGAGTAAATAATCCATCCAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-891s21c1
Sequence:CCGGGAGCATGTCAGTCGTTCAATACTCGAGTATTGAACGACTGACATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018060
VALIDATED
IARS2 MISSION shRNA shRNA Plasmid DNA
isoleucyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-2688s1c1
Sequence:CCGGGCAGATGTAATCGAGCTTAAACTCGAGTTTAAGCTCGATTACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-2012s1c1
Sequence:CCGGGCTTAGGAATACACTTCGCTTCTCGAGAAGCGAAGTGTATTCCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018060.2-118s1c1
Sequence:CCGGCAGAACTTTATTCATGGCAAACTCGAGTTTGCCATGAATAAAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-837s1c1
Sequence:CCGGGCAGATAAAGTAGCATCTGTTCTCGAGAACAGATGCTACTTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-549s1c1
Sequence:CCGGCGATCTTACAAACCTGTGTTTCTCGAGAAACACAGGTTTGTAAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-1091s21c1
Sequence:CCGGCTACGTACTGGCGGCAGATAACTCGAGTTATCTGCCGCCAGTACGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-1189s21c1
Sequence:CCGGGTACTTGCAGTCATCCATTAACTCGAGTTAATGGATGACTGCAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-2124s21c1
Sequence:CCGGCATCCTGATGTTGTCGTTAATCTCGAGATTAACGACAACATCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-3190s21c1
Sequence:CCGGGAAGTTTGGATGGATTATTTACTCGAGTAAATAATCCATCCAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-891s21c1
Sequence:CCGGGAGCATGTCAGTCGTTCAATACTCGAGTATTGAACGACTGACATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018060
VALIDATED
IARS2 MISSION shRNA Lentiviral Transduction Particles
isoleucyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-2688s1c1
Sequence:CCGGGCAGATGTAATCGAGCTTAAACTCGAGTTTAAGCTCGATTACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-2012s1c1
Sequence:CCGGGCTTAGGAATACACTTCGCTTCTCGAGAAGCGAAGTGTATTCCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018060.2-118s1c1
Sequence:CCGGCAGAACTTTATTCATGGCAAACTCGAGTTTGCCATGAATAAAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-837s1c1
Sequence:CCGGGCAGATAAAGTAGCATCTGTTCTCGAGAACAGATGCTACTTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018060.2-549s1c1
Sequence:CCGGCGATCTTACAAACCTGTGTTTCTCGAGAAACACAGGTTTGTAAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-1091s21c1
Sequence:CCGGCTACGTACTGGCGGCAGATAACTCGAGTTATCTGCCGCCAGTACGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-1189s21c1
Sequence:CCGGGTACTTGCAGTCATCCATTAACTCGAGTTAATGGATGACTGCAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-2124s21c1
Sequence:CCGGCATCCTGATGTTGTCGTTAATCTCGAGATTAACGACAACATCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-3190s21c1
Sequence:CCGGGAAGTTTGGATGGATTATTTACTCGAGTAAATAATCCATCCAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018060.3-891s21c1
Sequence:CCGGGAGCATGTCAGTCGTTCAATACTCGAGTATTGAACGACTGACATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)