EMAIL THIS PAGE TO A FRIEND

IBA57

IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)

51 Gene Product Result for
Synonyms: C1orf69 MMDS3
UniProtKB ID: Q5T440
Gene ID:
Mouse(216792) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Rat(363611) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
sheep(101122106) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
domestic guinea pig(100727534) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
naked mole-rat(101719992) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Zebrafish(100330979) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
cow(506009) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
domestic cat(101080354) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
dog(482207) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
chicken(420396) IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010867 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010867 Rosetta Predictions human pricing
NM_001108827 Rosetta Predictions rat pricing
NM_173785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225905 predicted 920
2 SASI_Hs01_00225906 predicted 1140
3 SASI_Hs01_00225908 predicted 751
4 SASI_Hs01_00225909 predicted 980
5 SASI_Hs01_00225910 predicted 1233
6 SASI_Hs02_00305823 predicted 994
7 SASI_Hs02_00305824 predicted 1000
8 SASI_Hs01_00225912 predicted 902
9 SASI_Hs01_00225913 predicted 1126
10 SASI_Hs01_00225914 predicted 1609
11 SASI_Hs01_00225907 predicted 909
12 SASI_Hs01_00225911 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242465 predicted 201
2 SASI_Rn02_00242466 predicted 243
3 SASI_Rn02_00242467 predicted 1260
4 SASI_Rn02_00242468 predicted 784
5 SASI_Rn02_00242469 predicted 322
6 SASI_Rn02_00242470 predicted 859
7 SASI_Rn02_00242471 predicted 1571
8 SASI_Rn02_00242472 predicted 1269
9 SASI_Rn02_00242473 predicted 362
10 SASI_Rn02_00242474 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151520 predicted 1319
2 SASI_Mm01_00151521 predicted 340
3 SASI_Mm01_00151522 predicted 1463
4 SASI_Mm01_00151523 predicted 367
5 SASI_Mm02_00345434 predicted 374
6 SASI_Mm01_00151524 predicted 1114
7 SASI_Mm01_00151525 predicted 1416
8 SASI_Mm01_00151526 predicted 1032
9 SASI_Mm02_00345435 predicted 868
10 SASI_Mm01_00151528 predicted 1454
11 SASI_Mm01_00151527 predicted 1425
12 SASI_Mm01_00151529 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173785
IBA57 MISSION shRNA Bacterial Glycerol Stock
IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-1018s1c1
Sequence:CCGGGCTGCGGTCAGAGACAATCAACTCGAGTTGATTGTCTCTGACCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173785.2-1318s1c1
Sequence:CCGGCCTACTCTTATGGGCTGTCTTCTCGAGAAGACAGCCCATAAGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-856s1c1
Sequence:CCGGGACCCACCATACAGGTGTCATCTCGAGATGACACCTGTATGGTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-466s1c1
Sequence:CCGGGCACCTCTCCATGTACAAGATCTCGAGATCTTGTACATGGAGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-257s1c1
Sequence:CCGGCTGTTGGGACTATCGACCAATCTCGAGATTGGTCGATAGTCCCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-818s21c1
Sequence:CCGGTCACGAAGGGCTGCTACATTGCTCGAGCAATGTAGCAGCCCTTCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173785.5-1415s21c1
Sequence:CCGGACCAGCTTCTGAACAAGATTTCTCGAGAAATCTTGTTCAGAAGCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-788s21c1
Sequence:CCGGCCAACCTGGTCTTCATGAATGCTCGAGCATTCATGAAGACCAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-365s21c1
Sequence:CCGGGCACGCTCTATGACGTCATTCCTCGAGGAATGACGTCATAGAGCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173785
IBA57 MISSION shRNA shRNA Plasmid DNA
IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-1018s1c1
Sequence:CCGGGCTGCGGTCAGAGACAATCAACTCGAGTTGATTGTCTCTGACCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173785.2-1318s1c1
Sequence:CCGGCCTACTCTTATGGGCTGTCTTCTCGAGAAGACAGCCCATAAGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-856s1c1
Sequence:CCGGGACCCACCATACAGGTGTCATCTCGAGATGACACCTGTATGGTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-466s1c1
Sequence:CCGGGCACCTCTCCATGTACAAGATCTCGAGATCTTGTACATGGAGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-257s1c1
Sequence:CCGGCTGTTGGGACTATCGACCAATCTCGAGATTGGTCGATAGTCCCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-818s21c1
Sequence:CCGGTCACGAAGGGCTGCTACATTGCTCGAGCAATGTAGCAGCCCTTCGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173785.5-1415s21c1
Sequence:CCGGACCAGCTTCTGAACAAGATTTCTCGAGAAATCTTGTTCAGAAGCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-788s21c1
Sequence:CCGGCCAACCTGGTCTTCATGAATGCTCGAGCATTCATGAAGACCAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-365s21c1
Sequence:CCGGGCACGCTCTATGACGTCATTCCTCGAGGAATGACGTCATAGAGCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173785
IBA57 MISSION shRNA Lentiviral Transduction Particles
IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-1018s1c1
Sequence:CCGGGCTGCGGTCAGAGACAATCAACTCGAGTTGATTGTCTCTGACCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173785.2-1318s1c1
Sequence:CCGGCCTACTCTTATGGGCTGTCTTCTCGAGAAGACAGCCCATAAGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-856s1c1
Sequence:CCGGGACCCACCATACAGGTGTCATCTCGAGATGACACCTGTATGGTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-466s1c1
Sequence:CCGGGCACCTCTCCATGTACAAGATCTCGAGATCTTGTACATGGAGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173785.2-257s1c1
Sequence:CCGGCTGTTGGGACTATCGACCAATCTCGAGATTGGTCGATAGTCCCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-818s21c1
Sequence:CCGGTCACGAAGGGCTGCTACATTGCTCGAGCAATGTAGCAGCCCTTCGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173785.5-1415s21c1
Sequence:CCGGACCAGCTTCTGAACAAGATTTCTCGAGAAATCTTGTTCAGAAGCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-788s21c1
Sequence:CCGGCCAACCTGGTCTTCATGAATGCTCGAGCATTCATGAAGACCAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173785.5-365s21c1
Sequence:CCGGGCACGCTCTATGACGTCATTCCTCGAGGAATGACGTCATAGAGCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010867
IBA57 MISSION shRNA Bacterial Glycerol Stock
IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-7059s1c1
Sequence:CCGGGCGACTGATTCCCTTACTTTACTCGAGTAAAGTAAGGGAATCAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3344s1c1
Sequence:CCGGCCTCTGTCATACAAACCAAATCTCGAGATTTGGTTTGTATGACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-7268s1c1
Sequence:CCGGGCATTTACATTCCCACCAGAACTCGAGTTCTGGTGGGAATGTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3343s1c1
Sequence:CCGGCCCTCTGTCATACAAACCAAACTCGAGTTTGGTTTGTATGACAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3605s1c1
Sequence:CCGGGCAGTTGTGTTATGTGGGTATCTCGAGATACCCACATAACACAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010867
IBA57 MISSION shRNA shRNA Plasmid DNA
IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-7059s1c1
Sequence:CCGGGCGACTGATTCCCTTACTTTACTCGAGTAAAGTAAGGGAATCAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3344s1c1
Sequence:CCGGCCTCTGTCATACAAACCAAATCTCGAGATTTGGTTTGTATGACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-7268s1c1
Sequence:CCGGGCATTTACATTCCCACCAGAACTCGAGTTCTGGTGGGAATGTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3343s1c1
Sequence:CCGGCCCTCTGTCATACAAACCAAACTCGAGTTTGGTTTGTATGACAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3605s1c1
Sequence:CCGGGCAGTTGTGTTATGTGGGTATCTCGAGATACCCACATAACACAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010867
IBA57 MISSION shRNA Lentiviral Transduction Particles
IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-7059s1c1
Sequence:CCGGGCGACTGATTCCCTTACTTTACTCGAGTAAAGTAAGGGAATCAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3344s1c1
Sequence:CCGGCCTCTGTCATACAAACCAAATCTCGAGATTTGGTTTGTATGACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-7268s1c1
Sequence:CCGGGCATTTACATTCCCACCAGAACTCGAGTTCTGGTGGGAATGTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3343s1c1
Sequence:CCGGCCCTCTGTCATACAAACCAAACTCGAGTTTGGTTTGTATGACAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010867.1-3605s1c1
Sequence:CCGGGCAGTTGTGTTATGTGGGTATCTCGAGATACCCACATAACACAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)