EMAIL THIS PAGE TO A FRIEND

IBSP

integrin-binding sialoprotein

52 Gene Product Result for
Synonyms: BNSP BSP BSP-II SP-II
UniProtKB ID: P21815
Gene ID:
Human(3381) Summary: The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
Mouse(15891) integrin binding sialoprotein
Rat(24477) integrin-binding sialoprotein
chicken(396071) integrin-binding sialoprotein
cow(281233) integrin-binding sialoprotein
domestic cat(101095252) integrin-binding sialoprotein
dog(609146) integrin-binding sialoprotein
sheep(101120495) integrin-binding sialoprotein
domestic guinea pig(100730180) integrin-binding sialoprotein
naked mole-rat(101725913) integrin-binding sialoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004967 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002051 MISSION® esiRNA esiRNA targeting human IBSP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004967 Rosetta Predictions human pricing
NM_012587 Rosetta Predictions rat pricing
NM_008318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338665 predicted 979
2 SASI_Hs01_00057213 predicted 195
3 SASI_Hs02_00338666 predicted 910
4 SASI_Hs02_00338667 predicted 893
5 SASI_Hs01_00057216 predicted 269
6 SASI_Hs02_00338668 predicted 967
7 SASI_Hs01_00057218 predicted 279
8 SASI_Hs01_00057221 predicted 259
9 SASI_Hs02_00338669 predicted 953
10 SASI_Hs01_00057222 predicted 816
11 SASI_Hs01_00057214 predicted 272
12 SASI_Hs01_00057215 predicted 263
13 SASI_Hs01_00057217 predicted 272
14 SASI_Hs01_00057219 predicted 325
15 SASI_Hs01_00057220 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085745 predicted 880
2 SASI_Rn01_00085740 predicted 224
3 SASI_Rn01_00085741 predicted 880
4 SASI_Rn01_00085742 predicted 899
5 SASI_Rn01_00085743 predicted 1416
6 SASI_Rn01_00085744 predicted 1446
7 SASI_Rn01_00085747 predicted 1405
8 SASI_Rn02_00259727 predicted 190
9 SASI_Rn01_00085749 predicted 688
10 SASI_Rn02_00259728 predicted 1008
11 SASI_Rn01_00085746 predicted 1544
12 SASI_Rn01_00085748 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098193 predicted 1021
2 SASI_Mm01_00098194 predicted 199
3 SASI_Mm02_00313633 predicted 264
4 SASI_Mm01_00098195 predicted 914
5 SASI_Mm01_00098196 predicted 1555
6 SASI_Mm02_00313634 predicted 1483
7 SASI_Mm02_00313635 predicted 1481
8 SASI_Mm01_00098198 predicted 886
9 SASI_Mm01_00098200 predicted 152
10 SASI_Mm01_00098201 predicted 1260
11 SASI_Mm01_00098197 predicted 211
12 SASI_Mm01_00098199 predicted 206
13 SASI_Mm01_00098202 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008318
IBSP MISSION shRNA Bacterial Glycerol Stock
integrin-binding sialoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008318.1-1385s1c1
Sequence:CCGGGCGCAAACATACCCTGTATAACTCGAGTTATACAGGGTATGTTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-202s1c1
Sequence:CCGGGCCACGCTACTTTCTTTATAACTCGAGTTATAAAGAAAGTAGCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-910s1c1
Sequence:CCGGCGAATACAACAATGAGTATGACTCGAGTCATACTCATTGTTGTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-332s1c1
Sequence:CCGGGAGACTTCAAACGAAGAGGAACTCGAGTTCCTCTTCGTTTGAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-907s1c1
Sequence:CCGGCAACGAATACAACAATGAGTACTCGAGTACTCATTGTTGTATTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008318
IBSP MISSION shRNA shRNA Plasmid DNA
integrin-binding sialoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008318.1-1385s1c1
Sequence:CCGGGCGCAAACATACCCTGTATAACTCGAGTTATACAGGGTATGTTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-202s1c1
Sequence:CCGGGCCACGCTACTTTCTTTATAACTCGAGTTATAAAGAAAGTAGCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-910s1c1
Sequence:CCGGCGAATACAACAATGAGTATGACTCGAGTCATACTCATTGTTGTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-332s1c1
Sequence:CCGGGAGACTTCAAACGAAGAGGAACTCGAGTTCCTCTTCGTTTGAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-907s1c1
Sequence:CCGGCAACGAATACAACAATGAGTACTCGAGTACTCATTGTTGTATTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008318
IBSP MISSION shRNA Lentiviral Transduction Particles
integrin-binding sialoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008318.1-1385s1c1
Sequence:CCGGGCGCAAACATACCCTGTATAACTCGAGTTATACAGGGTATGTTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-202s1c1
Sequence:CCGGGCCACGCTACTTTCTTTATAACTCGAGTTATAAAGAAAGTAGCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-910s1c1
Sequence:CCGGCGAATACAACAATGAGTATGACTCGAGTCATACTCATTGTTGTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-332s1c1
Sequence:CCGGGAGACTTCAAACGAAGAGGAACTCGAGTTCCTCTTCGTTTGAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008318.1-907s1c1
Sequence:CCGGCAACGAATACAACAATGAGTACTCGAGTACTCATTGTTGTATTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004967
IBSP MISSION shRNA Bacterial Glycerol Stock
integrin-binding sialoprotein
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-262s1c1
Sequence:CCGGGCCACGATATTATCTTTACAACTCGAGTTGTAAAGATAATATCGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-182s1c1
Sequence:CCGGGCCTGTGCTTTCTCAATGAAACTCGAGTTTCATTGAGAAAGCACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-389s1c1
Sequence:CCGGGAGACTTCAAATGAAGGAGAACTCGAGTTCTCCTTCATTTGAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-578s1c1
Sequence:CCGGGAGAAGGAAAGTGATGAAGAACTCGAGTTCTTCATCACTTTCCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004967
IBSP MISSION shRNA shRNA Plasmid DNA
integrin-binding sialoprotein
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-262s1c1
Sequence:CCGGGCCACGATATTATCTTTACAACTCGAGTTGTAAAGATAATATCGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-182s1c1
Sequence:CCGGGCCTGTGCTTTCTCAATGAAACTCGAGTTTCATTGAGAAAGCACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-389s1c1
Sequence:CCGGGAGACTTCAAATGAAGGAGAACTCGAGTTCTCCTTCATTTGAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-578s1c1
Sequence:CCGGGAGAAGGAAAGTGATGAAGAACTCGAGTTCTTCATCACTTTCCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004967
IBSP MISSION shRNA Lentiviral Transduction Particles
integrin-binding sialoprotein
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-262s1c1
Sequence:CCGGGCCACGATATTATCTTTACAACTCGAGTTGTAAAGATAATATCGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-182s1c1
Sequence:CCGGGCCTGTGCTTTCTCAATGAAACTCGAGTTTCATTGAGAAAGCACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-389s1c1
Sequence:CCGGGAGACTTCAAATGAAGGAGAACTCGAGTTCTCCTTCATTTGAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004967.2-578s1c1
Sequence:CCGGGAGAAGGAAAGTGATGAAGAACTCGAGTTCTTCATCACTTTCCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)