EMAIL THIS PAGE TO A FRIEND

IBTK

inhibitor of Bruton agammaglobulinemia tyrosine kinase

166 Gene Product Result for
Synonyms: BTBD26 BTKI RP1-93K22.1
Gene ID:
Human(25998) Summary: The protein encoded by this gene binds to Bruton's tyrosine kinase (BTK) and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. [provided by RefSeq, Jul 2008]
Mouse(108837) inhibitor of Bruton agammaglobulinemia tyrosine kinase
Rat(315858) inhibitor of Bruton agammaglobulinemia tyrosine kinase
domestic guinea pig(100730565) inhibitor of Bruton agammaglobulinemia tyrosine kinase
naked mole-rat(101721776) inhibitor of Bruton agammaglobulinemia tyrosine kinase
sheep(101114198) inhibitor of Bruton agammaglobulinemia tyrosine kinase
Domestic Rabbit(100354187) inhibitor of Bruton agammaglobulinemia tyrosine kinase
Zebrafish(572463) inhibitor of Bruton agammaglobulinemia tyrosine kinase
cow(540885) inhibitor of Bruton agammaglobulinemia tyrosine kinase
Horse(100065330) inhibitor of Bruton agammaglobulinemia tyrosine kinase
domestic cat(101085211) inhibitor of Bruton agammaglobulinemia tyrosine kinase
dog(481897) inhibitor of Bruton agammaglobulinemia tyrosine kinase
chicken(421844) inhibitor of Bruton agammaglobulinemia tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371835 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015525 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015525 Rosetta Predictions human pricing
XM_001062352 Rosetta Predictions rat pricing
XM_236481 Rosetta Predictions rat pricing
NM_001081282 Rosetta Predictions mouse pricing
XM_884665 Rosetta Predictions mouse pricing
XM_895761 Rosetta Predictions mouse pricing
XM_895772 Rosetta Predictions mouse pricing
XM_895779 Rosetta Predictions mouse pricing
XM_895790 Rosetta Predictions mouse pricing
XM_994806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348022 predicted 4467
2 SASI_Hs02_00348023 predicted 2203
3 SASI_Hs01_00178565 predicted 883
4 SASI_Hs02_00348024 predicted 1611
5 SASI_Hs01_00178568 predicted 3793
6 SASI_Hs02_00348025 predicted 1158
7 SASI_Hs01_00178571 predicted 2856
8 SASI_Hs01_00178572 predicted 936
9 SASI_Hs01_00178573 predicted 2045
10 SASI_Hs01_00178574 predicted 640
11 SASI_Hs01_00178566 predicted 3172
12 SASI_Hs01_00178567 predicted 1988
13 SASI_Hs01_00178569 predicted 1504
14 SASI_Hs01_00178570 predicted 3579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303200 predicted 2003
2 SASI_Rn02_00303201 predicted 739
3 SASI_Rn02_00303202 predicted 2627
4 SASI_Rn02_00303203 predicted 4568
5 SASI_Rn02_00303204 predicted 4427
6 SASI_Rn02_00303205 predicted 3626
7 SASI_Rn02_00303206 predicted 2738
8 SASI_Rn02_00303207 predicted 2325
9 SASI_Rn02_00303208 predicted 3011
10 SASI_Rn02_00303209 predicted 2333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390079 predicted 1241
2 SASI_Rn02_00390080 predicted 1280
3 SASI_Rn02_00390081 predicted 1863
4 SASI_Rn02_00390082 predicted 1457
5 SASI_Rn02_00390083 predicted 1042
6 SASI_Rn02_00390084 predicted 1968
7 SASI_Rn02_00390085 predicted 226
8 SASI_Rn02_00390086 predicted 1547
9 SASI_Rn02_00390087 predicted 2247
10 SASI_Rn02_00390088 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296947 predicted 2024
2 SASI_Mm02_00296948 predicted 3163
3 SASI_Mm02_00296949 predicted 1168
4 SASI_Mm02_00296950 predicted 3284
5 SASI_Mm02_00296951 predicted 579
6 SASI_Mm02_00296952 predicted 1309
7 SASI_Mm02_00296953 predicted 1224
8 SASI_Mm02_00296954 predicted 3376
9 SASI_Mm02_00296955 predicted 2010
10 SASI_Mm02_00296956 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220796 predicted 3165
2 SASI_Mm01_00220797 predicted 1175
3 SASI_Mm01_00220798 predicted 3286
4 SASI_Mm01_00220799 predicted 585
5 SASI_Mm01_00220800 predicted 1320
6 SASI_Mm01_00220801 predicted 1225
7 SASI_Mm01_00220802 predicted 3390
8 SASI_Mm01_00220803 predicted 2017
9 SASI_Mm01_00220804 predicted 1575
10 SASI_Mm01_00220805 predicted 2759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210913 predicted 4186
2 SASI_Mm01_00210914 predicted 3382
3 SASI_Mm01_00210915 predicted 3826
4 SASI_Mm01_00210916 predicted 4316
5 SASI_Mm01_00210917 predicted 4410
6 SASI_Mm01_00210918 predicted 5328
7 SASI_Mm01_00210919 predicted 3565
8 SASI_Mm01_00210920 predicted 3784
9 SASI_Mm01_00210921 predicted 5398
10 SASI_Mm01_00210922 predicted 4539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223641 predicted 4374
2 SASI_Mm01_00223642 predicted 2371
3 SASI_Mm01_00223643 predicted 4490
4 SASI_Mm01_00223644 predicted 1783
5 SASI_Mm01_00223645 predicted 2511
6 SASI_Mm01_00223646 predicted 2421
7 SASI_Mm01_00223647 predicted 4582
8 SASI_Mm01_00223648 predicted 3223
9 SASI_Mm01_00223649 predicted 2771
10 SASI_Mm01_00223650 predicted 3953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247703 predicted 3888
2 SASI_Mm01_00247704 predicted 2824
3 SASI_Mm01_00247705 predicted 2844
4 SASI_Mm01_00247706 predicted 3199
5 SASI_Mm01_00247707 predicted 2926
6 SASI_Mm01_00247708 predicted 3844
7 SASI_Mm01_00247709 predicted 3916
8 SASI_Mm01_00247710 predicted 3057
9 SASI_Mm01_00247711 predicted 3034
10 SASI_Mm01_00247712 predicted 2813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214324 predicted 3940
2 SASI_Mm01_00214325 predicted 3227
3 SASI_Mm01_00214326 predicted 2372
4 SASI_Mm01_00214327 predicted 1784
5 SASI_Mm01_00214328 predicted 2510
6 SASI_Mm01_00214329 predicted 2422
7 SASI_Mm01_00214330 predicted 3128
8 SASI_Mm01_00214331 predicted 2295
9 SASI_Mm01_00214332 predicted 3222
10 SASI_Mm01_00214333 predicted 2774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262756 predicted 3278
2 SASI_Mm01_00262757 predicted 1274
3 SASI_Mm01_00262758 predicted 3395
4 SASI_Mm01_00262759 predicted 692
5 SASI_Mm01_00262760 predicted 1419
6 SASI_Mm01_00262761 predicted 1336
7 SASI_Mm01_00262762 predicted 3485
8 SASI_Mm01_00262763 predicted 2127
9 SASI_Mm01_00262764 predicted 1680
10 SASI_Mm01_00262765 predicted 2866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371835
VALIDATED
IBTK MISSION shRNA Bacterial Glycerol Stock
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-4974s1c1
Sequence:CCGGGCCAAGTATGTGTTGTTGCTTCTCGAGAAGCAACAACACATACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-2084s1c1
Sequence:CCGGGCTGTTAGTGTCAGCACAGATCTCGAGATCTGTGCTGACACTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-3218s1c1
Sequence:CCGGCAGTTGAAACTGTCTTGTTTACTCGAGTAAACAAGACAGTTTCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-4440s1c1
Sequence:CCGGCTCTTATTAGAAGTCGAGAAACTCGAGTTTCTCGACTTCTAATAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-3725s1c1
Sequence:CCGGGCGAAAGTCAAACCGTATGTTCTCGAGAACATACGGTTTGACTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371835
VALIDATED
IBTK MISSION shRNA shRNA Plasmid DNA
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-4974s1c1
Sequence:CCGGGCCAAGTATGTGTTGTTGCTTCTCGAGAAGCAACAACACATACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-2084s1c1
Sequence:CCGGGCTGTTAGTGTCAGCACAGATCTCGAGATCTGTGCTGACACTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-3218s1c1
Sequence:CCGGCAGTTGAAACTGTCTTGTTTACTCGAGTAAACAAGACAGTTTCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-4440s1c1
Sequence:CCGGCTCTTATTAGAAGTCGAGAAACTCGAGTTTCTCGACTTCTAATAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-3725s1c1
Sequence:CCGGGCGAAAGTCAAACCGTATGTTCTCGAGAACATACGGTTTGACTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371835
VALIDATED
IBTK MISSION shRNA Lentiviral Transduction Particles
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-4974s1c1
Sequence:CCGGGCCAAGTATGTGTTGTTGCTTCTCGAGAAGCAACAACACATACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-2084s1c1
Sequence:CCGGGCTGTTAGTGTCAGCACAGATCTCGAGATCTGTGCTGACACTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-3218s1c1
Sequence:CCGGCAGTTGAAACTGTCTTGTTTACTCGAGTAAACAAGACAGTTTCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-4440s1c1
Sequence:CCGGCTCTTATTAGAAGTCGAGAAACTCGAGTTTCTCGACTTCTAATAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:XM_371835.1-3725s1c1
Sequence:CCGGGCGAAAGTCAAACCGTATGTTCTCGAGAACATACGGTTTGACTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135030
VALIDATED
IBTK MISSION shRNA Bacterial Glycerol Stock
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-3120s1c1
Sequence:CCGGGCTTCTCATAACTCGGTTAAACTCGAGTTTAACCGAGTTATGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-4973s1c1
Sequence:CCGGGCCGCATAAGATGTTATGTTACTCGAGTAACATAACATCTTATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-879s1c1
Sequence:CCGGGCATGGTGTTAGCTTGTATATCTCGAGATATACAAGCTAACACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-3471s1c1
Sequence:CCGGCTCGGAAACTATGTTCAAGAACTCGAGTTCTTGAACATAGTTTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135030.6-2035s1c1
Sequence:CCGGCCTGATACAAATAGTGTGTATCTCGAGATACACACTATTTGTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135030
VALIDATED
IBTK MISSION shRNA shRNA Plasmid DNA
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-3120s1c1
Sequence:CCGGGCTTCTCATAACTCGGTTAAACTCGAGTTTAACCGAGTTATGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-4973s1c1
Sequence:CCGGGCCGCATAAGATGTTATGTTACTCGAGTAACATAACATCTTATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-879s1c1
Sequence:CCGGGCATGGTGTTAGCTTGTATATCTCGAGATATACAAGCTAACACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-3471s1c1
Sequence:CCGGCTCGGAAACTATGTTCAAGAACTCGAGTTCTTGAACATAGTTTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135030.6-2035s1c1
Sequence:CCGGCCTGATACAAATAGTGTGTATCTCGAGATACACACTATTTGTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135030
VALIDATED
IBTK MISSION shRNA Lentiviral Transduction Particles
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-3120s1c1
Sequence:CCGGGCTTCTCATAACTCGGTTAAACTCGAGTTTAACCGAGTTATGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-4973s1c1
Sequence:CCGGGCCGCATAAGATGTTATGTTACTCGAGTAACATAACATCTTATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-879s1c1
Sequence:CCGGGCATGGTGTTAGCTTGTATATCTCGAGATATACAAGCTAACACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135030.6-3471s1c1
Sequence:CCGGCTCGGAAACTATGTTCAAGAACTCGAGTTCTTGAACATAGTTTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135030.6-2035s1c1
Sequence:CCGGCCTGATACAAATAGTGTGTATCTCGAGATACACACTATTTGTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081282
IBTK MISSION shRNA Bacterial Glycerol Stock
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000354127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-3377s21c1
Sequence:CCGGCTCGGAAACTATGTTCAAGAACTCGAGTTCTTGAACATAGTTTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-785s21c1
Sequence:CCGGGCATGGTGTTAGCTTGTATATCTCGAGATATACAAGCTAACACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-3026s21c1
Sequence:CCGGGCTTCTCATAACTCGGTTAAACTCGAGTTTAACCGAGTTATGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081282.1-4879s21c1
Sequence:CCGGGCCGCATAAGATGTTATGTTACTCGAGTAACATAACATCTTATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081282
IBTK MISSION shRNA shRNA Plasmid DNA
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000354127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-3377s21c1
Sequence:CCGGCTCGGAAACTATGTTCAAGAACTCGAGTTCTTGAACATAGTTTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-785s21c1
Sequence:CCGGGCATGGTGTTAGCTTGTATATCTCGAGATATACAAGCTAACACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-3026s21c1
Sequence:CCGGGCTTCTCATAACTCGGTTAAACTCGAGTTTAACCGAGTTATGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081282.1-4879s21c1
Sequence:CCGGGCCGCATAAGATGTTATGTTACTCGAGTAACATAACATCTTATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081282
IBTK MISSION shRNA Lentiviral Transduction Particles
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000354127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-3377s21c1
Sequence:CCGGCTCGGAAACTATGTTCAAGAACTCGAGTTCTTGAACATAGTTTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-785s21c1
Sequence:CCGGGCATGGTGTTAGCTTGTATATCTCGAGATATACAAGCTAACACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081282.1-3026s21c1
Sequence:CCGGGCTTCTCATAACTCGGTTAAACTCGAGTTTAACCGAGTTATGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081282.1-4879s21c1
Sequence:CCGGGCCGCATAAGATGTTATGTTACTCGAGTAACATAACATCTTATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015525
IBTK MISSION shRNA Bacterial Glycerol Stock
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000333741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015525.2-3702s21c1
Sequence:CCGGGCGAAAGTCAAACCGTATGTTCTCGAGAACATACGGTTTGACTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015525.2-4951s21c1
Sequence:CCGGGCCAAGTATGTGTTGTTGCTTCTCGAGAAGCAACAACACATACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015525.2-2061s21c1
Sequence:CCGGGCTGTTAGTGTCAGCACAGATCTCGAGATCTGTGCTGACACTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015525
IBTK MISSION shRNA shRNA Plasmid DNA
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000333741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015525.2-3702s21c1
Sequence:CCGGGCGAAAGTCAAACCGTATGTTCTCGAGAACATACGGTTTGACTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015525.2-4951s21c1
Sequence:CCGGGCCAAGTATGTGTTGTTGCTTCTCGAGAAGCAACAACACATACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015525.2-2061s21c1
Sequence:CCGGGCTGTTAGTGTCAGCACAGATCTCGAGATCTGTGCTGACACTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015525
IBTK MISSION shRNA Lentiviral Transduction Particles
inhibitor of Bruton agammaglobulinemia tyrosine kinase
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000333741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015525.2-3702s21c1
Sequence:CCGGGCGAAAGTCAAACCGTATGTTCTCGAGAACATACGGTTTGACTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015525.2-4951s21c1
Sequence:CCGGGCCAAGTATGTGTTGTTGCTTCTCGAGAAGCAACAACACATACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015525.2-2061s21c1
Sequence:CCGGGCTGTTAGTGTCAGCACAGATCTCGAGATCTGTGCTGACACTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)