EMAIL THIS PAGE TO A FRIEND

ICA1

islet cell autoantigen 1, 69kDa

127 Gene Product Result for
Synonyms: ICA69 ICAp69
UniProtKB ID: Q05084, A8K7U1, P78506, Q13824
Gene ID:
Human(3382) Summary: This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(15893) islet cell autoantigen 1
Rat(81024) islet cell autoantigen 1
Zebrafish(437003) islet cell autoantigen 1
chicken(420581) islet cell autoantigen 1, 69kDa
domestic cat(101097468) islet cell autoantigen 1, 69kDa
cow(535346) islet cell autoantigen 1, 69kDa
Horse(100052438) islet cell autoantigen 1, 69kDa
dog(475242) islet cell autoantigen 1, 69kDa
sheep(101121340) islet cell autoantigen 1, 69kDa
Domestic Rabbit(100357484) islet cell autoantigen 1, 69kDa
domestic guinea pig(100715341) islet cell autoantigen 1, 69kDa
naked mole-rat(101709102) islet cell autoantigen 1, 69kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004968 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004968 Rosetta Predictions human pricing
NM_022307 Rosetta Predictions human pricing
NM_030844 Rosetta Predictions rat pricing
NM_010492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103911 predicted 441
2 SASI_Hs01_00103912 predicted 387
3 SASI_Hs01_00103913 predicted 561
4 SASI_Hs01_00103914 predicted 1174
5 SASI_Hs01_00103915 predicted 1315
6 SASI_Hs01_00103916 predicted 411
7 SASI_Hs01_00103917 predicted 1620
8 SASI_Hs01_00103918 predicted 1633
9 SASI_Hs01_00103919 predicted 1215
10 SASI_Hs01_00103920 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148715 predicted 307
2 SASI_Hs01_00148716 predicted 260
3 SASI_Hs01_00148717 predicted 436
4 SASI_Hs01_00148718 predicted 1054
5 SASI_Hs01_00148719 predicted 1185
6 SASI_Hs01_00148720 predicted 291
7 SASI_Hs01_00148721 predicted 1493
8 SASI_Hs01_00148722 predicted 1504
9 SASI_Hs01_00148723 predicted 1089
10 SASI_Hs01_00148724 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066490 predicted 963
2 SASI_Rn01_00066491 predicted 487
3 SASI_Rn01_00066492 predicted 1065
4 SASI_Rn01_00066495 predicted 659
5 SASI_Rn01_00066496 predicted 1092
6 SASI_Rn01_00066497 predicted 339
7 SASI_Rn01_00066494 predicted 1211
8 SASI_Rn01_00066489 predicted 366
9 SASI_Rn02_00264073 predicted 1286
10 SASI_Rn02_00264074 predicted 876
11 SASI_Rn01_00066488 predicted 746
12 SASI_Rn01_00066493 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318732 predicted 1661
2 SASI_Mm02_00318733 predicted 1664
3 SASI_Mm02_00318734 predicted 1409
4 SASI_Mm02_00318735 predicted 1408
5 SASI_Mm02_00318736 predicted 1380
6 SASI_Mm02_00318737 predicted 527
7 SASI_Mm02_00318738 predicted 731
8 SASI_Mm02_00318739 predicted 1307
9 SASI_Mm02_00318740 predicted 1496
10 SASI_Mm02_00318741 predicted 553
11 SASI_Mm01_00027473 predicted 217
12 SASI_Mm01_00027474 predicted 1042
13 SASI_Mm01_00027475 predicted 1364
14 SASI_Mm01_00027476 predicted 1097
15 SASI_Mm01_00027477 predicted 497
16 SASI_Mm01_00027478 predicted 211
17 SASI_Mm01_00027479 predicted 1216
18 SASI_Mm01_00027480 predicted 1019
19 SASI_Mm01_00027481 predicted 324
20 SASI_Mm01_00027482 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004968
VALIDATED
ICA1 MISSION shRNA Bacterial Glycerol Stock
islet cell autoantigen 1, 69kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-1083s21c1
Sequence:CCGGGCAGGAGCCGAGCCAATTAATCTCGAGATTAATTGGCTCGGCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004968.2-1834s21c1
Sequence:CCGGTATCTCTATGTGGATCTAAATCTCGAGATTTAGATCCACATAGAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-1629s21c1
Sequence:CCGGCGAATTGCTCAATGCATGAATCTCGAGATTCATGCATTGAGCAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-372s21c1
Sequence:CCGGGCTAGAGCTGTTTCATTCAATCTCGAGATTGAATGAAACAGCTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-673s21c1
Sequence:CCGGGAACAGTGCAGGACGGAATATCTCGAGATATTCCGTCCTGCACTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-341s1c1
Sequence:CCGGGCCAAGCTAGAGCTGTTTCATCTCGAGATGAAACAGCTCTAGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-206s1c1
Sequence:CCGGCAGGATCGATATGCTCAAGATCTCGAGATCTTGAGCATATCGATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-1248s1c1
Sequence:CCGGCGAATTGCTCAATGCATGAATCTCGAGATTCATGCATTGAGCAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-346s1c1
Sequence:CCGGGCTAGAGCTGTTTCATTCAATCTCGAGATTGAATGAAACAGCTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004968.1-276s1c1
Sequence:CCGGCCTTTATTAAAGCCACAGGGACTCGAGTCCCTGTGGCTTTAATAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004968
VALIDATED
ICA1 MISSION shRNA shRNA Plasmid DNA
islet cell autoantigen 1, 69kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-1083s21c1
Sequence:CCGGGCAGGAGCCGAGCCAATTAATCTCGAGATTAATTGGCTCGGCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004968.2-1834s21c1
Sequence:CCGGTATCTCTATGTGGATCTAAATCTCGAGATTTAGATCCACATAGAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-1629s21c1
Sequence:CCGGCGAATTGCTCAATGCATGAATCTCGAGATTCATGCATTGAGCAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-372s21c1
Sequence:CCGGGCTAGAGCTGTTTCATTCAATCTCGAGATTGAATGAAACAGCTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-673s21c1
Sequence:CCGGGAACAGTGCAGGACGGAATATCTCGAGATATTCCGTCCTGCACTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-341s1c1
Sequence:CCGGGCCAAGCTAGAGCTGTTTCATCTCGAGATGAAACAGCTCTAGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-206s1c1
Sequence:CCGGCAGGATCGATATGCTCAAGATCTCGAGATCTTGAGCATATCGATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-1248s1c1
Sequence:CCGGCGAATTGCTCAATGCATGAATCTCGAGATTCATGCATTGAGCAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-346s1c1
Sequence:CCGGGCTAGAGCTGTTTCATTCAATCTCGAGATTGAATGAAACAGCTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004968.1-276s1c1
Sequence:CCGGCCTTTATTAAAGCCACAGGGACTCGAGTCCCTGTGGCTTTAATAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004968
VALIDATED
ICA1 MISSION shRNA Lentiviral Transduction Particles
islet cell autoantigen 1, 69kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-1083s21c1
Sequence:CCGGGCAGGAGCCGAGCCAATTAATCTCGAGATTAATTGGCTCGGCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004968.2-1834s21c1
Sequence:CCGGTATCTCTATGTGGATCTAAATCTCGAGATTTAGATCCACATAGAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-1629s21c1
Sequence:CCGGCGAATTGCTCAATGCATGAATCTCGAGATTCATGCATTGAGCAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-372s21c1
Sequence:CCGGGCTAGAGCTGTTTCATTCAATCTCGAGATTGAATGAAACAGCTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004968.2-673s21c1
Sequence:CCGGGAACAGTGCAGGACGGAATATCTCGAGATATTCCGTCCTGCACTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-341s1c1
Sequence:CCGGGCCAAGCTAGAGCTGTTTCATCTCGAGATGAAACAGCTCTAGCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-206s1c1
Sequence:CCGGCAGGATCGATATGCTCAAGATCTCGAGATCTTGAGCATATCGATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-1248s1c1
Sequence:CCGGCGAATTGCTCAATGCATGAATCTCGAGATTCATGCATTGAGCAATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004968.1-346s1c1
Sequence:CCGGGCTAGAGCTGTTTCATTCAATCTCGAGATTGAATGAAACAGCTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004968.1-276s1c1
Sequence:CCGGCCTTTATTAAAGCCACAGGGACTCGAGTCCCTGTGGCTTTAATAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010492
ICA1 MISSION shRNA Bacterial Glycerol Stock
islet cell autoantigen 1, 69kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-501s1c1
Sequence:CCGGGTTGGCCTTGAGAAACCCTTTCTCGAGAAAGGGTTTCTCAAGGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1040s1c1
Sequence:CCGGAGCACAAAGATTCATCTACTTCTCGAGAAGTAGATGAATCTTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1011s1c1
Sequence:CCGGGCCGAGGCAGTTAATTTCTTTCTCGAGAAAGAAATTAACTGCCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-201s1c1
Sequence:CCGGGCAGAAATATTGGGAGACCAACTCGAGTTGGTCTCCCAATATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1041s1c1
Sequence:CCGGGCACAAAGATTCATCTACTTACTCGAGTAAGTAGATGAATCTTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010492
ICA1 MISSION shRNA shRNA Plasmid DNA
islet cell autoantigen 1, 69kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-501s1c1
Sequence:CCGGGTTGGCCTTGAGAAACCCTTTCTCGAGAAAGGGTTTCTCAAGGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1040s1c1
Sequence:CCGGAGCACAAAGATTCATCTACTTCTCGAGAAGTAGATGAATCTTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1011s1c1
Sequence:CCGGGCCGAGGCAGTTAATTTCTTTCTCGAGAAAGAAATTAACTGCCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-201s1c1
Sequence:CCGGGCAGAAATATTGGGAGACCAACTCGAGTTGGTCTCCCAATATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1041s1c1
Sequence:CCGGGCACAAAGATTCATCTACTTACTCGAGTAAGTAGATGAATCTTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010492
ICA1 MISSION shRNA Lentiviral Transduction Particles
islet cell autoantigen 1, 69kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-501s1c1
Sequence:CCGGGTTGGCCTTGAGAAACCCTTTCTCGAGAAAGGGTTTCTCAAGGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1040s1c1
Sequence:CCGGAGCACAAAGATTCATCTACTTCTCGAGAAGTAGATGAATCTTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1011s1c1
Sequence:CCGGGCCGAGGCAGTTAATTTCTTTCTCGAGAAAGAAATTAACTGCCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-201s1c1
Sequence:CCGGGCAGAAATATTGGGAGACCAACTCGAGTTGGTCTCCCAATATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010492.2-1041s1c1
Sequence:CCGGGCACAAAGATTCATCTACTTACTCGAGTAAGTAGATGAATCTTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)