EMAIL THIS PAGE TO A FRIEND

ICA1L

islet cell autoantigen 1,69kDa-like

134 Gene Product Result for
Synonyms: ALS2CR14 ALS2CR15
Gene ID:
Mouse(70375) islet cell autoantigen 1-like
Rat(316432) islet cell autoantigen 1-like
domestic guinea pig(100723109) islet cell autoantigen 1,69kDa-like
naked mole-rat(101701378) islet cell autoantigen 1,69kDa-like
sheep(101111524) islet cell autoantigen 1,69kDa-like
cow(538992) islet cell autoantigen 1,69kDa-like
Horse(100067369) islet cell autoantigen 1,69kDa-like
domestic cat(101096828) islet cell autoantigen 1,69kDa-like
dog(488479) islet cell autoantigen 1,69kDa-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138468 Rosetta Predictions human pricing
NM_178231 Rosetta Predictions human pricing
NM_199400 Rosetta Predictions rat pricing
NM_027407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088614 predicted 1110
2 SASI_Hs01_00088615 predicted 1220
3 SASI_Hs01_00088616 predicted 1066
4 SASI_Hs01_00088617 predicted 573
5 SASI_Hs01_00088618 predicted 819
6 SASI_Hs01_00088619 predicted 233
7 SASI_Hs02_00363662 predicted 559
8 SASI_Hs01_00088620 predicted 497
9 SASI_Hs01_00088622 predicted 875
10 SASI_Hs01_00088623 predicted 1518
11 SASI_Hs01_00088621 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145069 predicted 680
2 SASI_Hs01_00145070 predicted 603
3 SASI_Hs02_00369604 predicted 560
4 SASI_Hs01_00145074 predicted 560
5 SASI_Hs02_00369605 predicted 614
6 SASI_Hs02_00369606 predicted 499
7 SASI_Hs01_00145077 predicted 617
8 SASI_Hs01_00145078 predicted 511
9 SASI_Hs02_00369607 predicted 612
10 SASI_Hs02_00369608 predicted 695
11 SASI_Hs01_00145071 predicted 626
12 SASI_Hs01_00145072 predicted 603
13 SASI_Hs01_00145073 predicted 592
14 SASI_Hs01_00145075 predicted 592
15 SASI_Hs01_00145076 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055789 predicted 597
2 SASI_Rn01_00055790 predicted 962
3 SASI_Rn01_00055792 predicted 350
4 SASI_Rn01_00055794 predicted 576
5 SASI_Rn02_00270225 predicted 229
6 SASI_Rn01_00055795 predicted 641
7 SASI_Rn01_00055796 predicted 769
8 SASI_Rn02_00270226 predicted 528
9 SASI_Rn01_00055797 predicted 212
10 SASI_Rn01_00055798 predicted 764
11 SASI_Rn01_00055791 predicted 852
12 SASI_Rn01_00055793 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080895 predicted 493
2 SASI_Mm01_00080896 predicted 1213
3 SASI_Mm01_00080897 predicted 1494
4 SASI_Mm01_00080898 predicted 1016
5 SASI_Mm01_00080899 predicted 703
6 SASI_Mm01_00080900 predicted 1007
7 SASI_Mm01_00080903 predicted 481
8 SASI_Mm01_00080904 predicted 685
9 SASI_Mm02_00332130 predicted 940
10 SASI_Mm02_00332131 predicted 1560
11 SASI_Mm01_00080901 predicted 1576
12 SASI_Mm01_00080902 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138468
VALIDATED
ICA1L MISSION shRNA Bacterial Glycerol Stock
islet cell autoantigen 1,69kDa-like
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-565s1c1
Sequence:CCGGCATTCAGTCAAAGGGCAGTATCTCGAGATACTGCCCTTTGACTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1047s1c1
Sequence:CCGGGCAAGCTTTGAGAGTGAACAACTCGAGTTGTTCACTCTCAAAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-873s1c1
Sequence:CCGGGCTCGAATGATGTCCCAAATTCTCGAGAATTTGGGACATCATTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1552s1c1
Sequence:CCGGCACTTTCAAACCCAGATGCTACTCGAGTAGCATCTGGGTTTGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138468.4-1606s21c1
Sequence:CCGGATGCTTGACTGAAGTTATAATCTCGAGATTATAACTTCAGTCAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-4466s21c1
Sequence:CCGGGAGCATATCAGTAACTATATTCTCGAGAATATAGTTACTGATATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138468.3-1734s1c1
Sequence:CCGGCCAACTTTAGACAGATGGTAACTCGAGTTACCATCTGTCTAAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-876s1c1
Sequence:CCGGCGAATGATGTCCCAAATTCATCTCGAGATGAATTTGGGACATCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1056s1c1
Sequence:CCGGGAGAGTGAACAAGCAAACAAACTCGAGTTTGTTTGCTTGTTCACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-723s21c1
Sequence:CCGGGTACAGATGCAAGTGAGAAATCTCGAGATTTCTCACTTGCATCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-812s21c1
Sequence:CCGGCTGCAATATGCTATCTCATTCCTCGAGGAATGAGATAGCATATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-680s21c1
Sequence:CCGGGCTGGACCCAGACACCTTAAACTCGAGTTTAAGGTGTCTGGGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138468.4-1011s21c1
Sequence:CCGGCTTACTGAACAGCTCAATAAGCTCGAGCTTATTGAGCTGTTCAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-778s21c1
Sequence:CCGGTTTGTCAGAAAGTGGATTTACCTCGAGGTAAATCCACTTTCTGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-593s21c1
Sequence:CCGGTGATACCTTGATGACAATTAACTCGAGTTAATTGTCATCAAGGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-5337s21c1
Sequence:CCGGGCGGTAGCTCACGCCTATATACTCGAGTATATAGGCGTGAGCTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138468
VALIDATED
ICA1L MISSION shRNA shRNA Plasmid DNA
islet cell autoantigen 1,69kDa-like
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-565s1c1
Sequence:CCGGCATTCAGTCAAAGGGCAGTATCTCGAGATACTGCCCTTTGACTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1047s1c1
Sequence:CCGGGCAAGCTTTGAGAGTGAACAACTCGAGTTGTTCACTCTCAAAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-873s1c1
Sequence:CCGGGCTCGAATGATGTCCCAAATTCTCGAGAATTTGGGACATCATTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1552s1c1
Sequence:CCGGCACTTTCAAACCCAGATGCTACTCGAGTAGCATCTGGGTTTGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138468.4-1606s21c1
Sequence:CCGGATGCTTGACTGAAGTTATAATCTCGAGATTATAACTTCAGTCAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-4466s21c1
Sequence:CCGGGAGCATATCAGTAACTATATTCTCGAGAATATAGTTACTGATATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138468.3-1734s1c1
Sequence:CCGGCCAACTTTAGACAGATGGTAACTCGAGTTACCATCTGTCTAAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-876s1c1
Sequence:CCGGCGAATGATGTCCCAAATTCATCTCGAGATGAATTTGGGACATCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1056s1c1
Sequence:CCGGGAGAGTGAACAAGCAAACAAACTCGAGTTTGTTTGCTTGTTCACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-723s21c1
Sequence:CCGGGTACAGATGCAAGTGAGAAATCTCGAGATTTCTCACTTGCATCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-812s21c1
Sequence:CCGGCTGCAATATGCTATCTCATTCCTCGAGGAATGAGATAGCATATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-680s21c1
Sequence:CCGGGCTGGACCCAGACACCTTAAACTCGAGTTTAAGGTGTCTGGGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138468.4-1011s21c1
Sequence:CCGGCTTACTGAACAGCTCAATAAGCTCGAGCTTATTGAGCTGTTCAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-778s21c1
Sequence:CCGGTTTGTCAGAAAGTGGATTTACCTCGAGGTAAATCCACTTTCTGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-593s21c1
Sequence:CCGGTGATACCTTGATGACAATTAACTCGAGTTAATTGTCATCAAGGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-5337s21c1
Sequence:CCGGGCGGTAGCTCACGCCTATATACTCGAGTATATAGGCGTGAGCTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138468
VALIDATED
ICA1L MISSION shRNA Lentiviral Transduction Particles
islet cell autoantigen 1,69kDa-like
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-565s1c1
Sequence:CCGGCATTCAGTCAAAGGGCAGTATCTCGAGATACTGCCCTTTGACTGAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1047s1c1
Sequence:CCGGGCAAGCTTTGAGAGTGAACAACTCGAGTTGTTCACTCTCAAAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-873s1c1
Sequence:CCGGGCTCGAATGATGTCCCAAATTCTCGAGAATTTGGGACATCATTCGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1552s1c1
Sequence:CCGGCACTTTCAAACCCAGATGCTACTCGAGTAGCATCTGGGTTTGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138468.4-1606s21c1
Sequence:CCGGATGCTTGACTGAAGTTATAATCTCGAGATTATAACTTCAGTCAAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-4466s21c1
Sequence:CCGGGAGCATATCAGTAACTATATTCTCGAGAATATAGTTACTGATATGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138468.3-1734s1c1
Sequence:CCGGCCAACTTTAGACAGATGGTAACTCGAGTTACCATCTGTCTAAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-876s1c1
Sequence:CCGGCGAATGATGTCCCAAATTCATCTCGAGATGAATTTGGGACATCATTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138468.3-1056s1c1
Sequence:CCGGGAGAGTGAACAAGCAAACAAACTCGAGTTTGTTTGCTTGTTCACTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-723s21c1
Sequence:CCGGGTACAGATGCAAGTGAGAAATCTCGAGATTTCTCACTTGCATCTGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-812s21c1
Sequence:CCGGCTGCAATATGCTATCTCATTCCTCGAGGAATGAGATAGCATATTGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-680s21c1
Sequence:CCGGGCTGGACCCAGACACCTTAAACTCGAGTTTAAGGTGTCTGGGTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138468.4-1011s21c1
Sequence:CCGGCTTACTGAACAGCTCAATAAGCTCGAGCTTATTGAGCTGTTCAGTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-778s21c1
Sequence:CCGGTTTGTCAGAAAGTGGATTTACCTCGAGGTAAATCCACTTTCTGACAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-593s21c1
Sequence:CCGGTGATACCTTGATGACAATTAACTCGAGTTAATTGTCATCAAGGTATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138468.4-5337s21c1
Sequence:CCGGGCGGTAGCTCACGCCTATATACTCGAGTATATAGGCGTGAGCTACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027407
ICA1L MISSION shRNA Bacterial Glycerol Stock
islet cell autoantigen 1,69kDa-like
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1155s1c1
Sequence:CCGGCAGACCTCAATAAGGTAGCTTCTCGAGAAGCTACCTTATTGAGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2425s1c1
Sequence:CCGGGCCTTCTGATTGCTAAGCAAACTCGAGTTTGCTTAGCAATCAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-728s21c1
Sequence:CCGGGACACCTTGGTGACCATTAACCTCGAGGTTAATGGTCACCAAGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-519s21c1
Sequence:CCGGAGCTAAGACTCAACGTTATATCTCGAGATATAACGTTGAGTCTTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2898s1c1
Sequence:CCGGCCTGAATATCTTAGCCTTAATCTCGAGATTAAGGCTAAGATATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1016s1c1
Sequence:CCGGCAGATGATGACCCAAATCCAACTCGAGTTGGATTTGGGTCATCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-945s1c1
Sequence:CCGGGCTGCAATATGCTGTCTCACTCTCGAGAGTGAGACAGCATATTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-592s21c1
Sequence:CCGGTTCGACTCAAGCTGGCGAAATCTCGAGATTTCGCCAGCTTGAGTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-384s1c1
Sequence:CCGGCCTTTATCAAAGCGACGGGAACTCGAGTTCCCGTCGCTTTGATAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2672s1c1
Sequence:CCGGGCAGGTTGATTCAGATTGAAACTCGAGTTTCAATCTGAATCAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-824s1c1
Sequence:CCGGGACACCTTCAAACAAATGGAACTCGAGTTCCATTTGTTTGAAGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-346s1c1
Sequence:CCGGGAGCAGAATGCAGAAGAACTACTCGAGTAGTTCTTCTGCATTCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1011s1c1
Sequence:CCGGCAGCTCAGATGATGACCCAAACTCGAGTTTGGGTCATCATCTGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027407
ICA1L MISSION shRNA shRNA Plasmid DNA
islet cell autoantigen 1,69kDa-like
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1155s1c1
Sequence:CCGGCAGACCTCAATAAGGTAGCTTCTCGAGAAGCTACCTTATTGAGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2425s1c1
Sequence:CCGGGCCTTCTGATTGCTAAGCAAACTCGAGTTTGCTTAGCAATCAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-728s21c1
Sequence:CCGGGACACCTTGGTGACCATTAACCTCGAGGTTAATGGTCACCAAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-519s21c1
Sequence:CCGGAGCTAAGACTCAACGTTATATCTCGAGATATAACGTTGAGTCTTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2898s1c1
Sequence:CCGGCCTGAATATCTTAGCCTTAATCTCGAGATTAAGGCTAAGATATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1016s1c1
Sequence:CCGGCAGATGATGACCCAAATCCAACTCGAGTTGGATTTGGGTCATCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-945s1c1
Sequence:CCGGGCTGCAATATGCTGTCTCACTCTCGAGAGTGAGACAGCATATTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-592s21c1
Sequence:CCGGTTCGACTCAAGCTGGCGAAATCTCGAGATTTCGCCAGCTTGAGTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-384s1c1
Sequence:CCGGCCTTTATCAAAGCGACGGGAACTCGAGTTCCCGTCGCTTTGATAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2672s1c1
Sequence:CCGGGCAGGTTGATTCAGATTGAAACTCGAGTTTCAATCTGAATCAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-824s1c1
Sequence:CCGGGACACCTTCAAACAAATGGAACTCGAGTTCCATTTGTTTGAAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-346s1c1
Sequence:CCGGGAGCAGAATGCAGAAGAACTACTCGAGTAGTTCTTCTGCATTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1011s1c1
Sequence:CCGGCAGCTCAGATGATGACCCAAACTCGAGTTTGGGTCATCATCTGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027407
ICA1L MISSION shRNA Lentiviral Transduction Particles
islet cell autoantigen 1,69kDa-like
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1155s1c1
Sequence:CCGGCAGACCTCAATAAGGTAGCTTCTCGAGAAGCTACCTTATTGAGGTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2425s1c1
Sequence:CCGGGCCTTCTGATTGCTAAGCAAACTCGAGTTTGCTTAGCAATCAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-728s21c1
Sequence:CCGGGACACCTTGGTGACCATTAACCTCGAGGTTAATGGTCACCAAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-519s21c1
Sequence:CCGGAGCTAAGACTCAACGTTATATCTCGAGATATAACGTTGAGTCTTAGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2898s1c1
Sequence:CCGGCCTGAATATCTTAGCCTTAATCTCGAGATTAAGGCTAAGATATTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1016s1c1
Sequence:CCGGCAGATGATGACCCAAATCCAACTCGAGTTGGATTTGGGTCATCATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-945s1c1
Sequence:CCGGGCTGCAATATGCTGTCTCACTCTCGAGAGTGAGACAGCATATTGCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027407.3-592s21c1
Sequence:CCGGTTCGACTCAAGCTGGCGAAATCTCGAGATTTCGCCAGCTTGAGTCGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-384s1c1
Sequence:CCGGCCTTTATCAAAGCGACGGGAACTCGAGTTCCCGTCGCTTTGATAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027407.2-2672s1c1
Sequence:CCGGGCAGGTTGATTCAGATTGAAACTCGAGTTTCAATCTGAATCAACCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-824s1c1
Sequence:CCGGGACACCTTCAAACAAATGGAACTCGAGTTCCATTTGTTTGAAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-346s1c1
Sequence:CCGGGAGCAGAATGCAGAAGAACTACTCGAGTAGTTCTTCTGCATTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027407.2-1011s1c1
Sequence:CCGGCAGCTCAGATGATGACCCAAACTCGAGTTTGGGTCATCATCTGAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178231
ICA1L MISSION shRNA Bacterial Glycerol Stock
islet cell autoantigen 1,69kDa-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-418s1c1
Sequence:CCGGCAGTAGTCAGAAGAATGCAAACTCGAGTTTGCATTCTTCTGACTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-408s1c1
Sequence:CCGGGATAATCAGTCAGTAGTCAGACTCGAGTCTGACTACTGACTGATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-590s1c1
Sequence:CCGGGAAATACCAGCTAAGACTCAACTCGAGTTGAGTCTTAGCTGGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-464s1c1
Sequence:CCGGCTTTATCAAAGCAACAGGAAACTCGAGTTTCCTGTTGCTTTGATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-565s1c1
Sequence:CCGGGCACTGAACTTCTGAAGATAACTCGAGTTATCTTCAGAAGTTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-599s1c1
Sequence:CCGGGCTAAGACTCAATGGTATGAACTCGAGTTCATACCATTGAGTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-516s1c1
Sequence:CCGGGCTGAACTGGATGCTAAACTTCTCGAGAAGTTTAGCATCCAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-587s1c1
Sequence:CCGGCGAGAAATACCAGCTAAGACTCTCGAGAGTCTTAGCTGGTATTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178231
ICA1L MISSION shRNA shRNA Plasmid DNA
islet cell autoantigen 1,69kDa-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-418s1c1
Sequence:CCGGCAGTAGTCAGAAGAATGCAAACTCGAGTTTGCATTCTTCTGACTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-408s1c1
Sequence:CCGGGATAATCAGTCAGTAGTCAGACTCGAGTCTGACTACTGACTGATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-590s1c1
Sequence:CCGGGAAATACCAGCTAAGACTCAACTCGAGTTGAGTCTTAGCTGGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-464s1c1
Sequence:CCGGCTTTATCAAAGCAACAGGAAACTCGAGTTTCCTGTTGCTTTGATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-565s1c1
Sequence:CCGGGCACTGAACTTCTGAAGATAACTCGAGTTATCTTCAGAAGTTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-599s1c1
Sequence:CCGGGCTAAGACTCAATGGTATGAACTCGAGTTCATACCATTGAGTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-516s1c1
Sequence:CCGGGCTGAACTGGATGCTAAACTTCTCGAGAAGTTTAGCATCCAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-587s1c1
Sequence:CCGGCGAGAAATACCAGCTAAGACTCTCGAGAGTCTTAGCTGGTATTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178231
ICA1L MISSION shRNA Lentiviral Transduction Particles
islet cell autoantigen 1,69kDa-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-418s1c1
Sequence:CCGGCAGTAGTCAGAAGAATGCAAACTCGAGTTTGCATTCTTCTGACTACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-408s1c1
Sequence:CCGGGATAATCAGTCAGTAGTCAGACTCGAGTCTGACTACTGACTGATTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-590s1c1
Sequence:CCGGGAAATACCAGCTAAGACTCAACTCGAGTTGAGTCTTAGCTGGTATTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-464s1c1
Sequence:CCGGCTTTATCAAAGCAACAGGAAACTCGAGTTTCCTGTTGCTTTGATAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-565s1c1
Sequence:CCGGGCACTGAACTTCTGAAGATAACTCGAGTTATCTTCAGAAGTTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-599s1c1
Sequence:CCGGGCTAAGACTCAATGGTATGAACTCGAGTTCATACCATTGAGTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-516s1c1
Sequence:CCGGGCTGAACTGGATGCTAAACTTCTCGAGAAGTTTAGCATCCAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178231.1-587s1c1
Sequence:CCGGCGAGAAATACCAGCTAAGACTCTCGAGAGTCTTAGCTGGTATTTCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)