EMAIL THIS PAGE TO A FRIEND

ICAM1

intercellular adhesion molecule 1

92 Gene Product Result for
Synonyms: BB2 CD54 P3.58
UniProtKB ID: P05362, B2R6M3, Q5NKV7, Q96B50
Gene ID:
Human(3383) Summary: This gene encodes a cell surface glycoprotein which is typically expressed on endothelial cells and cells of the immune system. It binds to integrins of type CD11a / CD18, or CD11b / CD18 and is also exploited by Rhinovirus as a receptor. [provided by RefSeq, Jul 2008]
Mouse(15894) intercellular adhesion molecule 1
Rat(25464) intercellular adhesion molecule 1
domestic guinea pig(100717967) intercellular adhesion molecule 1
naked mole-rat(101713679) intercellular adhesion molecule 1
dog(403975) intercellular adhesion molecule 1
cow(281839) intercellular adhesion molecule 1
domestic cat(101089421) intercellular adhesion molecule 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501486 Anti-ICAM-1, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4300383 Anti-ICAM1 (Ab-512) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2502120 Anti-ICAM1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1405977 Anti-ICAM1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA002126 Anti-ICAM1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA004877 Anti-ICAM1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4504435 Anti-phospho-ICAM-1 (pTyr512) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4300065 Anti-phospho-ICAM1 (pTyr512) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4700326 Monoclonal Anti-CD54 antibody produced in mouse clone MEM-112, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700327 Monoclonal Anti-CD54 antibody produced in mouse clone MEM-111, purified immunoglobulin, buffered aqueous solution bovine, human, rat
flow cytometry pricing
SAB4700571 Monoclonal Anti-CD54 antibody produced in rat clone YN1/1.7.4, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700572 Monoclonal Anti-CD54 low endotoxin antibody produced in rat clone YN1/1.7.4, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700329 Monoclonal Anti-CD54, azide free antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700330 Monoclonal Anti-CD54-APC antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700331 Monoclonal Anti-CD54-Biotin antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700332 Monoclonal Anti-CD54-FITC antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700573 Monoclonal Anti-CD54-FITC antibody produced in rat clone YN1/1.7.4, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700328 Monoclonal Anti-CD54-PE antibody produced in mouse clone MEM-111, purified immunoglobulin, buffered aqueous solution bovine, human, rat
flow cytometry pricing
SAB4700333 Monoclonal Anti-CD54-PE antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
C2969 Monoclonal Anti-I-CAM-1 (CD54) antibody produced in mouse clone 8.4A6, purified immunoglobulin monkey, human
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry pricing
WH0003383M1 Monoclonal Anti-ICAM1 antibody produced in mouse clone 3H8-2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB1379 Anti-CD54 Antibody, extracellular, clone 84H10 Detect CD54 using this Anti-CD54 Antibody, extracellular, clone 84H10 validated for use in FC, IP, IH. pricing
MABF711 Anti-CD54 (ICAM-1) Antibody (human), APC, clone 15.2 This mouse monoclonal antibody Anti-CD54 (ICAM-1) (human), APC, clone 15.2 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD54 (ICAM-1). pricing
MABF712 Anti-CD54 (ICAM-1) Antibody (human), APC, clone 15.2 This mouse monoclonal antibody Anti-CD54 (ICAM-1) (human), APC, clone 15.2 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD54 (ICAM-1). pricing
MABF713 Anti-CD54 (ICAM-1) Antibody (human), PE, clone 15.2 This mouse monoclonal antibody Anti-CD54 (ICAM-1) (human), PE, clone 15.2 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD54 (ICAM-1). pricing
MABF714 Anti-CD54 (ICAM-1) Antibody (human), PE, clone 15.2 This mouse monoclonal antibody Anti-CD54 (ICAM-1) (human), PE, clone 15.2 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD54 (ICAM-1). pricing
CBL450F Anti-ICAM-1 Antibody, clone 15.2, FITC conjugated This Anti-ICAM-1 Antibody, clone 15.2, FITC conjugated is validated for use in FC, IH for the detection of ICAM-1d. pricing
MAB1397Z Anti-ICAM-1 Antibody, clone 3E2B, Azide Free Anti-ICAM-1 Antibody, clone 3E2B, Azide Free detects level of ICAM-1 & has been published & validated for use in ELISA, FC, FUNC, IC, IH. pricing
MAB2146 Anti-ICAM-1 Antibody, clone P2A4 Anti-ICAM-1 Antibody, clone P2A4 is an antibody against ICAM-1 for use in ELISA, FC, IP, IC, IH. pricing
MAB2146Z Anti-ICAM-1 Antibody, clone P2A4, Azide Free This Anti-ICAM-1 Antibody, clone P2A4, Azide Free is validated for use in ELISA, FC, IP, IC, IH, FUNC for the detection of ICAM-1. pricing
MAB2130 Anti-ICAM-1 Antibody, clone W-CAM-1 Detect ICAM-1 using this Anti-ICAM-1 Antibody, clone W-CAM-1 validated for use in FC, IH(P). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000201 siRNAs that have been validated in the lab human pricing
NM_012967 Rosetta Predictions rat pricing
NM_010493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000201 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119067 validated 537
2 SASI_Hs01_00119068 predicted 2166
3 SASI_Hs02_00302074 predicted 2114
4 SASI_Hs01_00119069 predicted 2044
5 SASI_Hs01_00119070 predicted 541
6 SASI_Hs01_00119071 predicted 569
7 SASI_Hs01_00119072 predicted 2163
8 SASI_Hs01_00119073 predicted 1748
9 SASI_Hs01_00119075 predicted 1989
10 SASI_Hs02_00302075 predicted 859
11 SASI_Hs01_00119066 predicted 1352
12 SASI_Hs01_00119074 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094817 predicted 242
2 SASI_Rn01_00094818 predicted 1710
3 SASI_Rn01_00094819 predicted 254
4 SASI_Rn01_00094820 predicted 209
5 SASI_Rn01_00094821 predicted 1582
6 SASI_Rn01_00094822 predicted 998
7 SASI_Rn01_00094823 predicted 659
8 SASI_Rn01_00094824 predicted 809
9 SASI_Rn01_00094825 predicted 1418
10 SASI_Rn02_00260568 predicted 1407
11 SASI_Rn01_00094826 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158129 predicted 1605
2 SASI_Mm01_00158130 predicted 1603
3 SASI_Mm01_00158131 predicted 1501
4 SASI_Mm02_00318742 predicted 989
5 SASI_Mm01_00158132 predicted 388
6 SASI_Mm01_00158133 predicted 1486
7 SASI_Mm01_00158134 predicted 797
8 SASI_Mm01_00158135 predicted 708
9 SASI_Mm01_00158136 predicted 666
10 SASI_Mm01_00158137 predicted 1525
11 SASI_Mm01_00158138 predicted 1617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000201
ICAM1 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-1178s21c1
Sequence:CCGGCGGCTGACGTGTGCAGTAATACTCGAGTATTACTGCACACGTCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-1597s21c1
Sequence:CCGGGCCCGAGCTCAAGTGTCTAAACTCGAGTTTAGACACTTGAGCTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-851s21c1
Sequence:CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1488s1c1
Sequence:CCGGCCGGTATGAGATTGTCATCATCTCGAGATGATGACAATCTCATACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1548s1c1
Sequence:CCGGCCTCAGCACGTACCTCTATAACTCGAGTTATAGAGGTACGTGCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-216s1c1
Sequence:CCGGCCAGCCCAAGTTGTTGGGCATCTCGAGATGCCCAACAACTTGGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1572s1c1
Sequence:CCGGCCAGCGGAAGATCAAGAAATACTCGAGTATTTCTTGATCTTCCGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-320s1c1
Sequence:CCGGGCCAACCAATGTGCTATTCAACTCGAGTTGAATAGCACATTGGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000201
ICAM1 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-1178s21c1
Sequence:CCGGCGGCTGACGTGTGCAGTAATACTCGAGTATTACTGCACACGTCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-1597s21c1
Sequence:CCGGGCCCGAGCTCAAGTGTCTAAACTCGAGTTTAGACACTTGAGCTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-851s21c1
Sequence:CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1488s1c1
Sequence:CCGGCCGGTATGAGATTGTCATCATCTCGAGATGATGACAATCTCATACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1548s1c1
Sequence:CCGGCCTCAGCACGTACCTCTATAACTCGAGTTATAGAGGTACGTGCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-216s1c1
Sequence:CCGGCCAGCCCAAGTTGTTGGGCATCTCGAGATGCCCAACAACTTGGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1572s1c1
Sequence:CCGGCCAGCGGAAGATCAAGAAATACTCGAGTATTTCTTGATCTTCCGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-320s1c1
Sequence:CCGGGCCAACCAATGTGCTATTCAACTCGAGTTGAATAGCACATTGGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000201
ICAM1 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-1178s21c1
Sequence:CCGGCGGCTGACGTGTGCAGTAATACTCGAGTATTACTGCACACGTCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-1597s21c1
Sequence:CCGGGCCCGAGCTCAAGTGTCTAAACTCGAGTTTAGACACTTGAGCTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000201.2-851s21c1
Sequence:CCGGGATCACCATGGAGCCAATTTCCTCGAGGAAATTGGCTCCATGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1488s1c1
Sequence:CCGGCCGGTATGAGATTGTCATCATCTCGAGATGATGACAATCTCATACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1548s1c1
Sequence:CCGGCCTCAGCACGTACCTCTATAACTCGAGTTATAGAGGTACGTGCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-216s1c1
Sequence:CCGGCCAGCCCAAGTTGTTGGGCATCTCGAGATGCCCAACAACTTGGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-1572s1c1
Sequence:CCGGCCAGCGGAAGATCAAGAAATACTCGAGTATTTCTTGATCTTCCGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000201.1-320s1c1
Sequence:CCGGGCCAACCAATGTGCTATTCAACTCGAGTTGAATAGCACATTGGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010493
VALIDATED
ICAM1 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010493.2-813s21c1
Sequence:CCGGTGCCTCTGAAGCTCGGATATACTCGAGTATATCCGAGCTTCAGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1616s21c1
Sequence:CCGGAGATCAGGATATACAAGTTACCTCGAGGTAACTTGTATATCCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1929s21c1
Sequence:GTACCGGACGCTGACTTCATTCTCTATTCTCGAGAATAGAGAATGAAGTCAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1526s21c1
Sequence:CCGGATAACTGGACTATAATCATTCCTCGAGGAATGATTATAGTCCAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010493.2-383s21c1
Sequence:CCGGCCGCTACCATCACCGTGTATTCTCGAGAATACACGGTGATGGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010493.2-2052s1c1
Sequence:CCGGCCAACTCTTCTTGATGTATTTCTCGAGAAATACATCAAGAAGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-213s1c1
Sequence:CCGGGAACTGTTCTTCCTCATGCAACTCGAGTTGCATGAGGAAGAACAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-1606s1c1
Sequence:CCGGCGCCAGAGAAAGATCAGGATACTCGAGTATCCTGATCTTTCTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-984s1c1
Sequence:CCGGGCAGAGGACCTTAACAGTCTACTCGAGTAGACTGTTAAGGTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010493
VALIDATED
ICAM1 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010493.2-813s21c1
Sequence:CCGGTGCCTCTGAAGCTCGGATATACTCGAGTATATCCGAGCTTCAGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1616s21c1
Sequence:CCGGAGATCAGGATATACAAGTTACCTCGAGGTAACTTGTATATCCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1929s21c1
Sequence:GTACCGGACGCTGACTTCATTCTCTATTCTCGAGAATAGAGAATGAAGTCAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1526s21c1
Sequence:CCGGATAACTGGACTATAATCATTCCTCGAGGAATGATTATAGTCCAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010493.2-383s21c1
Sequence:CCGGCCGCTACCATCACCGTGTATTCTCGAGAATACACGGTGATGGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010493.2-2052s1c1
Sequence:CCGGCCAACTCTTCTTGATGTATTTCTCGAGAAATACATCAAGAAGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-213s1c1
Sequence:CCGGGAACTGTTCTTCCTCATGCAACTCGAGTTGCATGAGGAAGAACAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-1606s1c1
Sequence:CCGGCGCCAGAGAAAGATCAGGATACTCGAGTATCCTGATCTTTCTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-984s1c1
Sequence:CCGGGCAGAGGACCTTAACAGTCTACTCGAGTAGACTGTTAAGGTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010493
VALIDATED
ICAM1 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010493.2-813s21c1
Sequence:CCGGTGCCTCTGAAGCTCGGATATACTCGAGTATATCCGAGCTTCAGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1616s21c1
Sequence:CCGGAGATCAGGATATACAAGTTACCTCGAGGTAACTTGTATATCCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1929s21c1
Sequence:GTACCGGACGCTGACTTCATTCTCTATTCTCGAGAATAGAGAATGAAGTCAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010493.2-1526s21c1
Sequence:CCGGATAACTGGACTATAATCATTCCTCGAGGAATGATTATAGTCCAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010493.2-383s21c1
Sequence:CCGGCCGCTACCATCACCGTGTATTCTCGAGAATACACGGTGATGGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010493.2-2052s1c1
Sequence:CCGGCCAACTCTTCTTGATGTATTTCTCGAGAAATACATCAAGAAGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-213s1c1
Sequence:CCGGGAACTGTTCTTCCTCATGCAACTCGAGTTGCATGAGGAAGAACAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-1606s1c1
Sequence:CCGGCGCCAGAGAAAGATCAGGATACTCGAGTATCCTGATCTTTCTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010493.2-984s1c1
Sequence:CCGGGCAGAGGACCTTAACAGTCTACTCGAGTAGACTGTTAAGGTCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)