EMAIL THIS PAGE TO A FRIEND

ICAM3

intercellular adhesion molecule 3

32 Gene Product Result for
Synonyms: CD50 CDW50 ICAM-R
UniProtKB ID: P32942, Q6PD68
Gene ID:
Human(3385) Summary: The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is constitutively and abundantly expressed by all leucocytes and may be the most important ligand for LFA-1 in the initiation of the immune response. It functions not only as an adhesion molecule, but also as a potent signalling molecule. [provided by RefSeq, Jul 2008]
dog(100683931) intercellular adhesion molecule 3
cow(281840) intercellular adhesion molecule 3
domestic cat(101094485) intercellular adhesion molecule 3
domestic guinea pig(100719077) intercellular adhesion molecule 3
naked mole-rat(101707806) intercellular adhesion molecule 3
sheep(101113326) intercellular adhesion molecule 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501489 Anti-CD50 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
HPA049820 Anti-ICAM3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4504138 Anti-phospho-CD50/ICAM-3 (pSer518) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4700335 Monoclonal Anti-CD50 antibody produced in mouse clone MEM-171, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700334 Monoclonal Anti-CD50, low endotoxin antibody produced in mouse clone MEM-04, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry pricing
SAB4700337 Monoclonal Anti-CD50-Biotin antibody produced in mouse clone MEM-171, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700339 Monoclonal Anti-CD50-PE antibody produced in mouse clone MEM-171, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0003385M1 Monoclonal Anti-ICAM3 antibody produced in mouse clone 2F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
I9031 Monoclonal Anti-Intracellular Adhesion Molecule 3 antibody produced in mouse ~1 mg/mL, clone 186-2G9, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0678 Human ICAM3 / Intercellular Adhesion Molecule 3 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002162 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002181 MISSION® esiRNA esiRNA targeting human ICAM3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002162 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145493 predicted 971
2 SASI_Hs01_00145494 predicted 1115
3 SASI_Hs02_00333372 predicted 220
4 SASI_Hs02_00333373 predicted 915
5 SASI_Hs01_00145496 predicted 1039
6 SASI_Hs01_00145497 predicted 1186
7 SASI_Hs01_00145498 predicted 1396
8 SASI_Hs01_00145500 predicted 326
9 SASI_Hs01_00145501 predicted 1517
10 SASI_Hs01_00145502 predicted 691
11 SASI_Hs01_00145495 predicted 882
12 SASI_Hs01_00145499 predicted 1397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002162
ICAM3 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-1447s21c1
Sequence:CCGGGTCCAGCTCACGAGGCAAATACTCGAGTATTTGCCTCGTGAGCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-248s21c1
Sequence:CCGGTTGGAGACGTCCCTATCAAAGCTCGAGCTTTGATAGGGACGTCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-205s21c1
Sequence:CCGGTGTGAACTGCAGTACTGATTGCTCGAGCAATCAGTACTGCAGTTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-1600s21c1
Sequence:CCGGGAGCGGCAGTTACCATGTTAGCTCGAGCTAACATGGTAACTGCCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1084s1c1
Sequence:CCGGCCAGCTCAACTTCAGCTAAATCTCGAGATTTAGCTGAAGTTGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1513s1c1
Sequence:CCGGGTGACTATCGTACTGGCCTTACTCGAGTAAGGCCAGTACGATAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-931s1c1
Sequence:CCGGCGGGAGAACTTGACGGTCTTTCTCGAGAAAGACCGTCAAGTTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-336s1c1
Sequence:CCGGCTCCTCTAACATCACCGTGTACTCGAGTACACGGTGATGTTAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1242s1c1
Sequence:CCGGGCACTTGAAATGGAAAGATAACTCGAGTTATCTTTCCATTTCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002162
ICAM3 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-1447s21c1
Sequence:CCGGGTCCAGCTCACGAGGCAAATACTCGAGTATTTGCCTCGTGAGCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-248s21c1
Sequence:CCGGTTGGAGACGTCCCTATCAAAGCTCGAGCTTTGATAGGGACGTCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-205s21c1
Sequence:CCGGTGTGAACTGCAGTACTGATTGCTCGAGCAATCAGTACTGCAGTTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-1600s21c1
Sequence:CCGGGAGCGGCAGTTACCATGTTAGCTCGAGCTAACATGGTAACTGCCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1084s1c1
Sequence:CCGGCCAGCTCAACTTCAGCTAAATCTCGAGATTTAGCTGAAGTTGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1513s1c1
Sequence:CCGGGTGACTATCGTACTGGCCTTACTCGAGTAAGGCCAGTACGATAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-931s1c1
Sequence:CCGGCGGGAGAACTTGACGGTCTTTCTCGAGAAAGACCGTCAAGTTCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-336s1c1
Sequence:CCGGCTCCTCTAACATCACCGTGTACTCGAGTACACGGTGATGTTAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1242s1c1
Sequence:CCGGGCACTTGAAATGGAAAGATAACTCGAGTTATCTTTCCATTTCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002162
ICAM3 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-1447s21c1
Sequence:CCGGGTCCAGCTCACGAGGCAAATACTCGAGTATTTGCCTCGTGAGCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-248s21c1
Sequence:CCGGTTGGAGACGTCCCTATCAAAGCTCGAGCTTTGATAGGGACGTCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-205s21c1
Sequence:CCGGTGTGAACTGCAGTACTGATTGCTCGAGCAATCAGTACTGCAGTTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002162.3-1600s21c1
Sequence:CCGGGAGCGGCAGTTACCATGTTAGCTCGAGCTAACATGGTAACTGCCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1084s1c1
Sequence:CCGGCCAGCTCAACTTCAGCTAAATCTCGAGATTTAGCTGAAGTTGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1513s1c1
Sequence:CCGGGTGACTATCGTACTGGCCTTACTCGAGTAAGGCCAGTACGATAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-931s1c1
Sequence:CCGGCGGGAGAACTTGACGGTCTTTCTCGAGAAAGACCGTCAAGTTCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-336s1c1
Sequence:CCGGCTCCTCTAACATCACCGTGTACTCGAGTACACGGTGATGTTAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002162.2-1242s1c1
Sequence:CCGGGCACTTGAAATGGAAAGATAACTCGAGTTATCTTTCCATTTCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)