EMAIL THIS PAGE TO A FRIEND

ICAM4

intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)

92 Gene Product Result for
Synonyms: CD242 LW
UniProtKB ID: Q14773, A0M8X2, Q14771, Q14772, Q16375, Q9BWR0
Gene ID:
Human(3386) Summary: This gene encodes the Landsteiner-Wiener (LW) blood group antigen(s) that belongs to the immunoglobulin (Ig) superfamily, and that shares similarity with the intercellular adhesion molecule (ICAM) protein family. This ICAM protein contains 2 Ig-like C2-type domains and binds to the leukocyte adhesion LFA-1 protein. The molecular basis of the LW(A)/LW(B) blood group antigens is a single aa variation at position 100; Gln-100=LW(A) and Arg-100=LW(B). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(78369) intercellular adhesion molecule 4, Landsteiner-Wiener blood group
Rat(298702) intercellular adhesion molecule 4, Landsteiner-Wiener blood group
sheep(101116476) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
domestic guinea pig(100718248) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
naked mole-rat(101707452) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
cow(514873) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
domestic cat(101093754) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
dog(611265) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001544 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039132 Rosetta Predictions human pricing
NM_001544 Rosetta Predictions human pricing
NM_022377 Rosetta Predictions human pricing
NM_023892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025737 predicted 750
2 SASI_Hs01_00025738 predicted 1150
3 SASI_Hs02_00308435 predicted 597
4 SASI_Hs01_00025739 predicted 423
5 SASI_Hs01_00025740 predicted 113
6 SASI_Hs01_00025741 predicted 521
7 SASI_Hs01_00025742 predicted 466
8 SASI_Hs01_00025743 predicted 369
9 SASI_Hs01_00025744 predicted 730
10 SASI_Hs01_00025745 predicted 620
11 SASI_Hs01_00025746 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175166 predicted 829
2 SASI_Hs01_00175167 predicted 1230
3 SASI_Hs02_00332085 predicted 671
4 SASI_Hs01_00175168 predicted 108
5 SASI_Hs01_00175169 predicted 596
6 SASI_Hs01_00175170 predicted 544
7 SASI_Hs02_00332086 predicted 601
8 SASI_Hs01_00175171 predicted 374
9 SASI_Hs02_00332087 predicted 454
10 SASI_Hs01_00175172 predicted 812
11 SASI_Hs01_00175173 predicted 704
12 SASI_Hs01_00175174 predicted 521
13 SASI_Hs01_00175175 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136067 predicted 975
2 SASI_Hs02_00355684 predicted 617
3 SASI_Hs02_00355685 predicted 672
4 SASI_Hs01_00136068 predicted 108
5 SASI_Hs01_00136069 predicted 595
6 SASI_Hs01_00136070 predicted 842
7 SASI_Hs01_00136071 predicted 537
8 SASI_Hs01_00136072 predicted 603
9 SASI_Hs01_00136073 predicted 459
10 SASI_Hs01_00136074 predicted 979
11 SASI_Hs01_00136075 predicted 959
12 SASI_Hs01_00136076 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168151 predicted 525
2 SASI_Mm01_00168152 predicted 573
3 SASI_Mm02_00327434 predicted 506
4 SASI_Mm02_00327435 predicted 425
5 SASI_Mm02_00327436 predicted 202
6 SASI_Mm01_00168153 predicted 618
7 SASI_Mm01_00168154 predicted 601
8 SASI_Mm02_00327437 predicted 252
9 SASI_Mm01_00168155 predicted 461
10 SASI_Mm02_00327438 predicted 296
11 SASI_Mm01_00168156 predicted 221
12 SASI_Mm01_00168157 predicted 406
13 SASI_Mm01_00168158 predicted 545
14 SASI_Mm01_00168159 predicted 385
15 SASI_Mm01_00168160 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001544
ICAM4 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-789s1c1
Sequence:CCGGCCTATGCAAGTGCCTAGCTATCTCGAGATAGCTAGGCACTTGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-579s1c1
Sequence:CCGGCGTGACCTTGACCTACGAGTTCTCGAGAACTCGTAGGTCAAGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-689s1c1
Sequence:CCGGCCATTACACTGATGCTCGCTTCTCGAGAAGCGAGCATCAGTGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-524s1c1
Sequence:CCGGGCCGGGTCATCTATTCCGAAACTCGAGTTTCGGAATAGATGACCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-434s1c1
Sequence:CCGGCGGTCTTAAAGGGCAGGAAATCTCGAGATTTCCTGCCCTTTAAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-785s21c1
Sequence:CCGGTTGTAGGGATCCTCCTCACTGCTCGAGCAGTGAGGAGGATCCCTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-415s21c1
Sequence:CCGGTCCAGGATCACCGCCTACAAACTCGAGTTTGTAGGCGGTGATCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-224s21c1
Sequence:CCGGGGAAGTCAGTGCAGCTCAATTCTCGAGAATTGAGCTGCACTGACTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001544
ICAM4 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-789s1c1
Sequence:CCGGCCTATGCAAGTGCCTAGCTATCTCGAGATAGCTAGGCACTTGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-579s1c1
Sequence:CCGGCGTGACCTTGACCTACGAGTTCTCGAGAACTCGTAGGTCAAGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-689s1c1
Sequence:CCGGCCATTACACTGATGCTCGCTTCTCGAGAAGCGAGCATCAGTGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-524s1c1
Sequence:CCGGGCCGGGTCATCTATTCCGAAACTCGAGTTTCGGAATAGATGACCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-434s1c1
Sequence:CCGGCGGTCTTAAAGGGCAGGAAATCTCGAGATTTCCTGCCCTTTAAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-785s21c1
Sequence:CCGGTTGTAGGGATCCTCCTCACTGCTCGAGCAGTGAGGAGGATCCCTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-415s21c1
Sequence:CCGGTCCAGGATCACCGCCTACAAACTCGAGTTTGTAGGCGGTGATCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-224s21c1
Sequence:CCGGGGAAGTCAGTGCAGCTCAATTCTCGAGAATTGAGCTGCACTGACTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001544
ICAM4 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-789s1c1
Sequence:CCGGCCTATGCAAGTGCCTAGCTATCTCGAGATAGCTAGGCACTTGCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-579s1c1
Sequence:CCGGCGTGACCTTGACCTACGAGTTCTCGAGAACTCGTAGGTCAAGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-689s1c1
Sequence:CCGGCCATTACACTGATGCTCGCTTCTCGAGAAGCGAGCATCAGTGTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-524s1c1
Sequence:CCGGGCCGGGTCATCTATTCCGAAACTCGAGTTTCGGAATAGATGACCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001544.2-434s1c1
Sequence:CCGGCGGTCTTAAAGGGCAGGAAATCTCGAGATTTCCTGCCCTTTAAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-785s21c1
Sequence:CCGGTTGTAGGGATCCTCCTCACTGCTCGAGCAGTGAGGAGGATCCCTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-415s21c1
Sequence:CCGGTCCAGGATCACCGCCTACAAACTCGAGTTTGTAGGCGGTGATCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001544.3-224s21c1
Sequence:CCGGGGAAGTCAGTGCAGCTCAATTCTCGAGAATTGAGCTGCACTGACTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023892
ICAM4 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-613s1c1
Sequence:CCGGCGCCTCAATCTCGACGGGCTACTCGAGTAGCCCGTCGAGATTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-491s1c1
Sequence:CCGGGCCGAGTGATTTATCATGAAACTCGAGTTTCATGATAAATCACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-528s1c1
Sequence:CCGGCGGTTCAGATTTGGCTAATGTCTCGAGACATTAGCCAAATCTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-124s1c1
Sequence:CCGGGTGCGTCTTAATCCAGAGCTACTCGAGTAGCTCTGGATTAAGACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-232s1c1
Sequence:CCGGCGGCAGGGAAAGATAGTTAATCTCGAGATTAACTATCTTTCCCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023892
ICAM4 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-613s1c1
Sequence:CCGGCGCCTCAATCTCGACGGGCTACTCGAGTAGCCCGTCGAGATTGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-491s1c1
Sequence:CCGGGCCGAGTGATTTATCATGAAACTCGAGTTTCATGATAAATCACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-528s1c1
Sequence:CCGGCGGTTCAGATTTGGCTAATGTCTCGAGACATTAGCCAAATCTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-124s1c1
Sequence:CCGGGTGCGTCTTAATCCAGAGCTACTCGAGTAGCTCTGGATTAAGACGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-232s1c1
Sequence:CCGGCGGCAGGGAAAGATAGTTAATCTCGAGATTAACTATCTTTCCCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023892
ICAM4 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-613s1c1
Sequence:CCGGCGCCTCAATCTCGACGGGCTACTCGAGTAGCCCGTCGAGATTGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-491s1c1
Sequence:CCGGGCCGAGTGATTTATCATGAAACTCGAGTTTCATGATAAATCACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-528s1c1
Sequence:CCGGCGGTTCAGATTTGGCTAATGTCTCGAGACATTAGCCAAATCTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-124s1c1
Sequence:CCGGGTGCGTCTTAATCCAGAGCTACTCGAGTAGCTCTGGATTAAGACGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023892.1-232s1c1
Sequence:CCGGCGGCAGGGAAAGATAGTTAATCTCGAGATTAACTATCTTTCCCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)