EMAIL THIS PAGE TO A FRIEND

ICAM5

intercellular adhesion molecule 5, telencephalin

71 Gene Product Result for
Synonyms: TLCN TLN
UniProtKB ID: Q9UMF0, Q9Y6F3
Gene ID:
Human(7087) Summary: The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008]
Mouse(15898) intercellular adhesion molecule 5, telencephalin
Rat(313785) intercellular adhesion molecule 5, telencephalin
dog(484958) intercellular adhesion molecule 5, telencephalin
domestic cat(101089676) intercellular adhesion molecule 5, telencephalin
cow(505158) intercellular adhesion molecule 5, telencephalin
domestic guinea pig(100718526) intercellular adhesion molecule 5, telencephalin
naked mole-rat(101714031) intercellular adhesion molecule 5, telencephalin
sheep(101116726) intercellular adhesion molecule 5, telencephalin
Domestic Rabbit(100328960) intercellular adhesion molecule 5, telencephalin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1509 Human ICAM-5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003259 Rosetta Predictions human pricing
XM_001077293 Rosetta Predictions rat pricing
XM_233737 Rosetta Predictions rat pricing
NM_008319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045818 predicted 210
2 SASI_Hs01_00045819 predicted 899
3 SASI_Hs01_00045820 predicted 1471
4 SASI_Hs01_00045821 predicted 1256
5 SASI_Hs01_00045822 predicted 564
6 SASI_Hs01_00045823 predicted 1630
7 SASI_Hs01_00045824 predicted 998
8 SASI_Hs01_00045825 predicted 1497
9 SASI_Hs01_00045826 predicted 878
10 SASI_Hs01_00045827 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356568 predicted 557
2 SASI_Rn02_00356569 predicted 2428
3 SASI_Rn02_00356570 predicted 2011
4 SASI_Rn02_00356571 predicted 440
5 SASI_Rn02_00356572 predicted 770
6 SASI_Rn02_00356573 predicted 775
7 SASI_Rn02_00356574 predicted 297
8 SASI_Rn02_00356575 predicted 231
9 SASI_Rn02_00356576 predicted 2134
10 SASI_Rn02_00356577 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388010 predicted 553
2 SASI_Rn02_00388011 predicted 2431
3 SASI_Rn02_00388012 predicted 2007
4 SASI_Rn02_00388013 predicted 449
5 SASI_Rn02_00388014 predicted 761
6 SASI_Rn02_00388015 predicted 773
7 SASI_Rn02_00388016 predicted 293
8 SASI_Rn02_00388017 predicted 239
9 SASI_Rn02_00388018 predicted 2133
10 SASI_Rn02_00388019 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313636 predicted 246
2 SASI_Mm01_00049513 predicted 1960
3 SASI_Mm02_00313637 predicted 982
4 SASI_Mm01_00049514 predicted 416
5 SASI_Mm02_00313638 predicted 893
6 SASI_Mm02_00313639 predicted 2215
7 SASI_Mm01_00049518 predicted 1578
8 SASI_Mm01_00049519 predicted 668
9 SASI_Mm02_00313640 predicted 2499
10 SASI_Mm01_00049521 predicted 744
11 SASI_Mm01_00049515 predicted 361
12 SASI_Mm01_00049516 predicted 706
13 SASI_Mm01_00049517 predicted 1022
14 SASI_Mm01_00049520 predicted 1142
15 SASI_Mm01_00049522 predicted 2621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003259
ICAM5 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 5, telencephalin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003259.3-1502s21c1
Sequence:CCGGGGTCAAGGACGTAACGCTAACCTCGAGGTTAGCGTTACGTCCTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003259.3-1264s21c1
Sequence:CCGGCAGAGCTTCGTGTCCTATACGCTCGAGCGTATAGGACACGAAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-778s1c1
Sequence:CCGGTCTTGGAAGTTGGCTCGGAAACTCGAGTTTCCGAGCCAACTTCCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-1555s1c1
Sequence:CCGGGCTGCCCAGAACGCATTACTTCTCGAGAAGTAATGCGTTCTGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-2068s1c1
Sequence:CCGGTGGATGAATCTACCTGCCCAACTCGAGTTGGGCAGGTAGATTCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-2345s1c1
Sequence:CCGGCCCAGGAGGAAACTTCACGTTCTCGAGAACGTGAAGTTTCCTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-867s1c1
Sequence:CCGGGACCAGAATCTGAGTCCTGATCTCGAGATCAGGACTCAGATTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003259
ICAM5 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 5, telencephalin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003259.3-1502s21c1
Sequence:CCGGGGTCAAGGACGTAACGCTAACCTCGAGGTTAGCGTTACGTCCTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003259.3-1264s21c1
Sequence:CCGGCAGAGCTTCGTGTCCTATACGCTCGAGCGTATAGGACACGAAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-778s1c1
Sequence:CCGGTCTTGGAAGTTGGCTCGGAAACTCGAGTTTCCGAGCCAACTTCCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-1555s1c1
Sequence:CCGGGCTGCCCAGAACGCATTACTTCTCGAGAAGTAATGCGTTCTGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-2068s1c1
Sequence:CCGGTGGATGAATCTACCTGCCCAACTCGAGTTGGGCAGGTAGATTCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-2345s1c1
Sequence:CCGGCCCAGGAGGAAACTTCACGTTCTCGAGAACGTGAAGTTTCCTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-867s1c1
Sequence:CCGGGACCAGAATCTGAGTCCTGATCTCGAGATCAGGACTCAGATTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003259
ICAM5 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 5, telencephalin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003259.3-1502s21c1
Sequence:CCGGGGTCAAGGACGTAACGCTAACCTCGAGGTTAGCGTTACGTCCTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003259.3-1264s21c1
Sequence:CCGGCAGAGCTTCGTGTCCTATACGCTCGAGCGTATAGGACACGAAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-778s1c1
Sequence:CCGGTCTTGGAAGTTGGCTCGGAAACTCGAGTTTCCGAGCCAACTTCCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-1555s1c1
Sequence:CCGGGCTGCCCAGAACGCATTACTTCTCGAGAAGTAATGCGTTCTGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-2068s1c1
Sequence:CCGGTGGATGAATCTACCTGCCCAACTCGAGTTGGGCAGGTAGATTCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-2345s1c1
Sequence:CCGGCCCAGGAGGAAACTTCACGTTCTCGAGAACGTGAAGTTTCCTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003259.2-867s1c1
Sequence:CCGGGACCAGAATCTGAGTCCTGATCTCGAGATCAGGACTCAGATTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008319
ICAM5 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 5, telencephalin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1908s1c1
Sequence:CCGGCCTCAAACTCTGGTCCTAGAACTCGAGTTCTAGGACCAGAGTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1141s1c1
Sequence:CCGGGCTCCAGTTAAATGTTACAAACTCGAGTTTGTAACATTTAACTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1530s1c1
Sequence:CCGGGCTGCCCAGAACATATTACTTCTCGAGAAGTAATATGTTCTGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1740s1c1
Sequence:CCGGCGGTGGAATATGGTCCCAGTTCTCGAGAACTGGGACCATATTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-370s1c1
Sequence:CCGGGCGTGGACTCATCCGAACTTTCTCGAGAAAGTTCGGATGAGTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008319
ICAM5 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 5, telencephalin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1908s1c1
Sequence:CCGGCCTCAAACTCTGGTCCTAGAACTCGAGTTCTAGGACCAGAGTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1141s1c1
Sequence:CCGGGCTCCAGTTAAATGTTACAAACTCGAGTTTGTAACATTTAACTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1530s1c1
Sequence:CCGGGCTGCCCAGAACATATTACTTCTCGAGAAGTAATATGTTCTGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1740s1c1
Sequence:CCGGCGGTGGAATATGGTCCCAGTTCTCGAGAACTGGGACCATATTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-370s1c1
Sequence:CCGGGCGTGGACTCATCCGAACTTTCTCGAGAAAGTTCGGATGAGTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008319
ICAM5 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 5, telencephalin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1908s1c1
Sequence:CCGGCCTCAAACTCTGGTCCTAGAACTCGAGTTCTAGGACCAGAGTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1141s1c1
Sequence:CCGGGCTCCAGTTAAATGTTACAAACTCGAGTTTGTAACATTTAACTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1530s1c1
Sequence:CCGGGCTGCCCAGAACATATTACTTCTCGAGAAGTAATATGTTCTGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-1740s1c1
Sequence:CCGGCGGTGGAATATGGTCCCAGTTCTCGAGAACTGGGACCATATTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008319.1-370s1c1
Sequence:CCGGGCGTGGACTCATCCGAACTTTCTCGAGAAAGTTCGGATGAGTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)