EMAIL THIS PAGE TO A FRIEND

ICK

intestinal cell (MAK-like) kinase

229 Gene Product Result for
Synonyms: ECO LCK2 MRK
Gene ID:
Human(22858) Summary: Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]
Mouse(56542) intestinal cell kinase
Rat(84411) intestinal cell kinase
sheep(101107478) intestinal cell (MAK-like) kinase
domestic guinea pig(100731366) intestinal cell (MAK-like) kinase
naked mole-rat(101715354) intestinal cell (MAK-like) kinase
chicken(421896) intestinal cell (MAK-like) kinase
domestic cat(101085288) intestinal cell (MAK-like) kinase
cow(506286) intestinal cell (MAK-like) kinase
Horse(100056645) intestinal cell (MAK-like) kinase
dog(481843) intestinal cell (MAK-like) kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014920 siRNAs that have been validated in the lab human pricing
NM_016513 Rosetta Predictions human pricing
NM_138886 Rosetta Predictions rat pricing
NM_019987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014920 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000055 validated 5933
1 SASI_WI_00000056 validated 4870
1 SASI_WI_00000057 validated 557
2 SASI_Hs01_00103458 predicted 1315
3 SASI_Hs02_00346566 predicted 1100
4 SASI_Hs01_00103459 predicted 1601
5 SASI_Hs01_00103460 predicted 1613
6 SASI_Hs01_00103461 predicted 1056
7 SASI_Hs01_00103462 predicted 1920
8 SASI_Hs01_00103463 predicted 939
9 SASI_Hs01_00103464 predicted 1194
10 SASI_Hs02_00346567 predicted 760
11 SASI_Hs01_00103465 predicted 879
12 SASI_Hs01_00103457 predicted 959
13 SASI_Hs01_00103466 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041048 predicted 1430
2 SASI_Hs02_00349604 predicted 1210
3 SASI_Hs01_00041049 predicted 1717
4 SASI_Hs01_00041050 predicted 1722
5 SASI_Hs01_00041051 predicted 1169
6 SASI_Hs01_00041052 predicted 2027
7 SASI_Hs01_00041053 predicted 1052
8 SASI_Hs01_00041054 predicted 1304
9 SASI_Hs02_00349605 predicted 869
10 SASI_Hs01_00041055 predicted 989
11 SASI_Hs01_00041047 predicted 1093
12 SASI_Hs01_00041056 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094491 predicted 1821
2 SASI_Rn02_00268320 predicted 1789
3 SASI_Rn01_00094492 predicted 1014
4 SASI_Rn01_00094493 predicted 773
5 SASI_Rn01_00094494 predicted 739
6 SASI_Rn01_00094496 predicted 1733
7 SASI_Rn01_00094497 predicted 597
8 SASI_Rn01_00094498 predicted 678
9 SASI_Rn01_00094499 predicted 1464
10 SASI_Rn02_00268321 predicted 589
11 SASI_Rn01_00094495 predicted 1030
12 SASI_Rn01_00094500 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023157 predicted 654
2 SASI_Mm01_00023158 predicted 1725
3 SASI_Mm01_00023159 predicted 958
4 SASI_Mm01_00023160 predicted 1049
5 SASI_Mm01_00023161 predicted 529
6 SASI_Mm01_00023162 predicted 1751
7 SASI_Mm02_00325329 predicted 1216
8 SASI_Mm01_00023165 predicted 973
9 SASI_Mm01_00023166 predicted 951
10 SASI_Mm02_00325330 predicted 1809
11 SASI_Mm01_00023163 predicted 971
12 SASI_Mm01_00023164 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014920
VALIDATED
ICK MISSION shRNA Bacterial Glycerol Stock
intestinal cell (MAK-like) kinase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-5485s1c1
Sequence:CCGGCCTACCATCAAGCCATTGTTTCTCGAGAAACAATGGCTTGATGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-1943s1c1
Sequence:CCGGGTCAGTAATCAGCAAAGTAAACTCGAGTTTACTTTGCTGATTACTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-955s1c1
Sequence:CCGGCCAGTGAAATTGACACAATATCTCGAGATATTGTGTCAATTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-706s1c1
Sequence:CCGGGCTTCTTTCATCGAGACTTAACTCGAGTTAAGTCTCGATGAAAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-608s1c1
Sequence:CCGGCCAGCTCATTAAAGAGAGAAACTCGAGTTTCTCTCTTTAATGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1862s21c1
Sequence:CCGGTACTTGCCTGGGATCAGTATACTCGAGTATACTGATCCCAGGCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-2698s21c1
Sequence:CCGGCTATGTGATAGAGGGTTATTTCTCGAGAAATAACCCTCTATCACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-2155s1c1
Sequence:CCGGGAAGCACTCCTGGGTTGATACCTCGAGGTATCAACCCAGGAGTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1975s21c1
Sequence:CCGGGTCAGTAATCAGCAAAGTAAACTCGAGTTTACTTTGCTGATTACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014920.3-1202s21c1
Sequence:GTACCGGGCTAGTCAGGCACTTCGATATCTCGAGATATCGAAGTGCCTGACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-1062s1c1
Sequence:CCGGCCACAGTGTGTACCCAATAACCTCGAGGTTATTGGGTACACACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-1993s1c1
Sequence:CCGGGTGGACTGACTGGAAACTATGCTCGAGCATAGTTTCCAGTCAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-706s21c1
Sequence:CCGGATTACAAGGACTCGCATTTATCTCGAGATAAATGCGAGTCCTTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014920.3-1359s21c1
Sequence:CCGGCCAAGCCACACACACGAATTTCTCGAGAAATTCGTGTGTGTGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1829s21c1
Sequence:GTACCGGGCAGCCAAGCAGCACTATTTGCTCGAGCAAATAGTGCTGCTTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-552s21c1
Sequence:GTACCGGACCATGCCAATGTAGTCAAATCTCGAGATTTGACTACATTGGCATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014920
VALIDATED
ICK MISSION shRNA shRNA Plasmid DNA
intestinal cell (MAK-like) kinase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-5485s1c1
Sequence:CCGGCCTACCATCAAGCCATTGTTTCTCGAGAAACAATGGCTTGATGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-1943s1c1
Sequence:CCGGGTCAGTAATCAGCAAAGTAAACTCGAGTTTACTTTGCTGATTACTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-955s1c1
Sequence:CCGGCCAGTGAAATTGACACAATATCTCGAGATATTGTGTCAATTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-706s1c1
Sequence:CCGGGCTTCTTTCATCGAGACTTAACTCGAGTTAAGTCTCGATGAAAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-608s1c1
Sequence:CCGGCCAGCTCATTAAAGAGAGAAACTCGAGTTTCTCTCTTTAATGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1862s21c1
Sequence:CCGGTACTTGCCTGGGATCAGTATACTCGAGTATACTGATCCCAGGCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-2698s21c1
Sequence:CCGGCTATGTGATAGAGGGTTATTTCTCGAGAAATAACCCTCTATCACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-2155s1c1
Sequence:CCGGGAAGCACTCCTGGGTTGATACCTCGAGGTATCAACCCAGGAGTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1975s21c1
Sequence:CCGGGTCAGTAATCAGCAAAGTAAACTCGAGTTTACTTTGCTGATTACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014920.3-1202s21c1
Sequence:GTACCGGGCTAGTCAGGCACTTCGATATCTCGAGATATCGAAGTGCCTGACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-1062s1c1
Sequence:CCGGCCACAGTGTGTACCCAATAACCTCGAGGTTATTGGGTACACACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-1993s1c1
Sequence:CCGGGTGGACTGACTGGAAACTATGCTCGAGCATAGTTTCCAGTCAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-706s21c1
Sequence:CCGGATTACAAGGACTCGCATTTATCTCGAGATAAATGCGAGTCCTTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014920.3-1359s21c1
Sequence:CCGGCCAAGCCACACACACGAATTTCTCGAGAAATTCGTGTGTGTGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1829s21c1
Sequence:GTACCGGGCAGCCAAGCAGCACTATTTGCTCGAGCAAATAGTGCTGCTTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-552s21c1
Sequence:GTACCGGACCATGCCAATGTAGTCAAATCTCGAGATTTGACTACATTGGCATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014920
VALIDATED
ICK MISSION shRNA Lentiviral Transduction Particles
intestinal cell (MAK-like) kinase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-5485s1c1
Sequence:CCGGCCTACCATCAAGCCATTGTTTCTCGAGAAACAATGGCTTGATGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-1943s1c1
Sequence:CCGGGTCAGTAATCAGCAAAGTAAACTCGAGTTTACTTTGCTGATTACTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-955s1c1
Sequence:CCGGCCAGTGAAATTGACACAATATCTCGAGATATTGTGTCAATTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-706s1c1
Sequence:CCGGGCTTCTTTCATCGAGACTTAACTCGAGTTAAGTCTCGATGAAAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014920.2-608s1c1
Sequence:CCGGCCAGCTCATTAAAGAGAGAAACTCGAGTTTCTCTCTTTAATGAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1862s21c1
Sequence:CCGGTACTTGCCTGGGATCAGTATACTCGAGTATACTGATCCCAGGCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-2698s21c1
Sequence:CCGGCTATGTGATAGAGGGTTATTTCTCGAGAAATAACCCTCTATCACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-2155s1c1
Sequence:CCGGGAAGCACTCCTGGGTTGATACCTCGAGGTATCAACCCAGGAGTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1975s21c1
Sequence:CCGGGTCAGTAATCAGCAAAGTAAACTCGAGTTTACTTTGCTGATTACTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014920.3-1202s21c1
Sequence:GTACCGGGCTAGTCAGGCACTTCGATATCTCGAGATATCGAAGTGCCTGACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-1062s1c1
Sequence:CCGGCCACAGTGTGTACCCAATAACCTCGAGGTTATTGGGTACACACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014920.2-1993s1c1
Sequence:CCGGGTGGACTGACTGGAAACTATGCTCGAGCATAGTTTCCAGTCAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-706s21c1
Sequence:CCGGATTACAAGGACTCGCATTTATCTCGAGATAAATGCGAGTCCTTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014920.3-1359s21c1
Sequence:CCGGCCAAGCCACACACACGAATTTCTCGAGAAATTCGTGTGTGTGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-1829s21c1
Sequence:GTACCGGGCAGCCAAGCAGCACTATTTGCTCGAGCAAATAGTGCTGCTTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014920.3-552s21c1
Sequence:GTACCGGACCATGCCAATGTAGTCAAATCTCGAGATTTGACTACATTGGCATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019987
VALIDATED
ICK MISSION shRNA Bacterial Glycerol Stock
intestinal cell (MAK-like) kinase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-1057s21c1
Sequence:CCGGGCTAGTCAGGCTCTTCGATATCTCGAGATATCGAAGAGCCTGACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.2-565s21c1
Sequence:CCGGTAATCATGCCAATATCGTAAACTCGAGTTTACGATATTGGCATGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019987.1-495s1c1
Sequence:CCGGCCAGCTCATTAAAGAAAGAAACTCGAGTTTCTTTCTTTAATGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019987.1-961s1c1
Sequence:CCGGCCCAATAACTTAAAGACTCTACTCGAGTAGAGTCTTTAAGTTATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019987.1-542s21c1
Sequence:CCGGGGAATATAATGTACCAGATATCTCGAGATATCTGGTACATTATATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-1204s1c1
Sequence:CCGGGCCAAGGCATATACGCTGATTCTCGAGAATCAGCGTATATGCCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-842s1c1
Sequence:CCGGCCAGTGAAATTGACACAATTTCTCGAGAAATTGTGTCAATTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-2172s1c1
Sequence:CCGGCACAACCACGAGGCGGTGTAACTCGAGTTACACCGCCTCGTGGTTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-378s21c1
Sequence:CCGGTCGGGAGGTTAAGTCTTTAAACTCGAGTTTAAAGACTTAACCTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019987.1-2172s21c1
Sequence:CCGGCACAACCACGAGGCGGTGTAACTCGAGTTACACCGCCTCGTGGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-1204s21c1
Sequence:CCGGGCCAAGGCATATACGCTGATTCTCGAGAATCAGCGTATATGCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019987
VALIDATED
ICK MISSION shRNA shRNA Plasmid DNA
intestinal cell (MAK-like) kinase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-1057s21c1
Sequence:CCGGGCTAGTCAGGCTCTTCGATATCTCGAGATATCGAAGAGCCTGACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.2-565s21c1
Sequence:CCGGTAATCATGCCAATATCGTAAACTCGAGTTTACGATATTGGCATGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019987.1-495s1c1
Sequence:CCGGCCAGCTCATTAAAGAAAGAAACTCGAGTTTCTTTCTTTAATGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019987.1-961s1c1
Sequence:CCGGCCCAATAACTTAAAGACTCTACTCGAGTAGAGTCTTTAAGTTATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019987.1-542s21c1
Sequence:CCGGGGAATATAATGTACCAGATATCTCGAGATATCTGGTACATTATATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-1204s1c1
Sequence:CCGGGCCAAGGCATATACGCTGATTCTCGAGAATCAGCGTATATGCCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-842s1c1
Sequence:CCGGCCAGTGAAATTGACACAATTTCTCGAGAAATTGTGTCAATTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-2172s1c1
Sequence:CCGGCACAACCACGAGGCGGTGTAACTCGAGTTACACCGCCTCGTGGTTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-378s21c1
Sequence:CCGGTCGGGAGGTTAAGTCTTTAAACTCGAGTTTAAAGACTTAACCTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019987.1-2172s21c1
Sequence:CCGGCACAACCACGAGGCGGTGTAACTCGAGTTACACCGCCTCGTGGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-1204s21c1
Sequence:CCGGGCCAAGGCATATACGCTGATTCTCGAGAATCAGCGTATATGCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019987
VALIDATED
ICK MISSION shRNA Lentiviral Transduction Particles
intestinal cell (MAK-like) kinase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-1057s21c1
Sequence:CCGGGCTAGTCAGGCTCTTCGATATCTCGAGATATCGAAGAGCCTGACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.2-565s21c1
Sequence:CCGGTAATCATGCCAATATCGTAAACTCGAGTTTACGATATTGGCATGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019987.1-495s1c1
Sequence:CCGGCCAGCTCATTAAAGAAAGAAACTCGAGTTTCTTTCTTTAATGAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019987.1-961s1c1
Sequence:CCGGCCCAATAACTTAAAGACTCTACTCGAGTAGAGTCTTTAAGTTATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019987.1-542s21c1
Sequence:CCGGGGAATATAATGTACCAGATATCTCGAGATATCTGGTACATTATATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-1204s1c1
Sequence:CCGGGCCAAGGCATATACGCTGATTCTCGAGAATCAGCGTATATGCCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-842s1c1
Sequence:CCGGCCAGTGAAATTGACACAATTTCTCGAGAAATTGTGTCAATTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019987.1-2172s1c1
Sequence:CCGGCACAACCACGAGGCGGTGTAACTCGAGTTACACCGCCTCGTGGTTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-378s21c1
Sequence:CCGGTCGGGAGGTTAAGTCTTTAAACTCGAGTTTAAAGACTTAACCTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019987.1-2172s21c1
Sequence:CCGGCACAACCACGAGGCGGTGTAACTCGAGTTACACCGCCTCGTGGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019987.1-1204s21c1
Sequence:CCGGGCCAAGGCATATACGCTGATTCTCGAGAATCAGCGTATATGCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)