EMAIL THIS PAGE TO A FRIEND

ICOS

inducible T-cell co-stimulator

171 Gene Product Result for
Synonyms: AILIM CD278 CVID1
UniProtKB ID: Q9Y6W8, Q8N6W8
Gene ID:
Human(29851) Summary: The protein encoded by this gene belongs to the CD28 and CTLA-4 cell-surface receptor family. It forms homodimers and plays an important role in cell-cell signaling, immune responses, and regulation of cell proliferation. [provided by RefSeq, Jul 2008]
Mouse(54167) inducible T cell co-stimulator
Rat(64545) inducible T-cell co-stimulator
chicken(424105) inducible T-cell co-stimulator
dog(403456) inducible T-cell co-stimulator
domestic cat(101089031) inducible T-cell co-stimulator
cow(507026) inducible T-cell co-stimulator
sheep(101113567) inducible T-cell co-stimulator
domestic guinea pig(100715533) inducible T-cell co-stimulator
naked mole-rat(101699352) inducible T-cell co-stimulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012092 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019561 MISSION® esiRNA esiRNA targeting human ICOS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012092 Rosetta Predictions human pricing
NM_022610 Rosetta Predictions rat pricing
NM_017480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163196 predicted 245
2 SASI_Hs01_00163197 predicted 288
3 SASI_Hs01_00163198 predicted 609
4 SASI_Hs01_00163200 predicted 434
5 SASI_Hs01_00163201 predicted 259
6 SASI_Hs02_00343593 predicted 389
7 SASI_Hs01_00163202 predicted 339
8 SASI_Hs01_00163203 predicted 771
9 SASI_Hs01_00163204 predicted 647
10 SASI_Hs01_00163205 predicted 238
11 SASI_Hs01_00163199 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263377 predicted 242
2 SASI_Rn01_00117705 predicted 292
3 SASI_Rn01_00117706 predicted 783
4 SASI_Rn01_00117707 predicted 284
5 SASI_Rn01_00117708 predicted 408
6 SASI_Rn01_00117709 predicted 723
7 SASI_Rn01_00117710 predicted 557
8 SASI_Rn01_00117711 predicted 653
9 SASI_Rn01_00117712 predicted 987
10 SASI_Rn01_00117713 predicted 1114
11 SASI_Rn01_00117704 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159711 predicted 1007
2 SASI_Mm01_00159712 predicted 420
3 SASI_Mm01_00159713 predicted 401
4 SASI_Mm01_00159714 predicted 491
5 SASI_Mm01_00159715 predicted 256
6 SASI_Mm01_00159716 predicted 292
7 SASI_Mm02_00323957 predicted 738
8 SASI_Mm01_00159718 predicted 212
9 SASI_Mm01_00159719 predicted 942
10 SASI_Mm01_00159720 predicted 352
11 SASI_Mm01_00159717 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012092
ICOS MISSION shRNA Bacterial Glycerol Stock
inducible T-cell co-stimulator
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-508s1c1
Sequence:CCGGGCATACTTATTTGTTGGCTTACTCGAGTAAGCCAACAAATAAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-481s1c1
Sequence:CCGGCCTTTGTTGTAGTCTGCATTTCTCGAGAAATGCAGACTACAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-335s1c1
Sequence:CCGGCCATTCTCATGCCAACTATTACTCGAGTAATAGTTGGCATGAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-449s1c1
Sequence:CCGGGCTGAAGTTCTGGTTACCCATCTCGAGATGGGTAACCAGAACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-109s1c1
Sequence:CCGGCTGCCAATTATGAGATGTTTACTCGAGTAAACATCTCATAATTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012092.3-586s21c1
Sequence:CCGGGCACGACCCTAACGGTGAATACTCGAGTATTCACCGTTAGGGTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012092.3-649s21c1
Sequence:CCGGCACAGATGTGACCCTATAATACTCGAGTATTATAGGGTCACATCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012092.3-1066s21c1
Sequence:CCGGGTCCGCATTTCACTATCATACCTCGAGGTATGATAGTGAAATGCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012092
ICOS MISSION shRNA shRNA Plasmid DNA
inducible T-cell co-stimulator
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-508s1c1
Sequence:CCGGGCATACTTATTTGTTGGCTTACTCGAGTAAGCCAACAAATAAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-481s1c1
Sequence:CCGGCCTTTGTTGTAGTCTGCATTTCTCGAGAAATGCAGACTACAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-335s1c1
Sequence:CCGGCCATTCTCATGCCAACTATTACTCGAGTAATAGTTGGCATGAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-449s1c1
Sequence:CCGGGCTGAAGTTCTGGTTACCCATCTCGAGATGGGTAACCAGAACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-109s1c1
Sequence:CCGGCTGCCAATTATGAGATGTTTACTCGAGTAAACATCTCATAATTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012092.3-586s21c1
Sequence:CCGGGCACGACCCTAACGGTGAATACTCGAGTATTCACCGTTAGGGTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012092.3-649s21c1
Sequence:CCGGCACAGATGTGACCCTATAATACTCGAGTATTATAGGGTCACATCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012092.3-1066s21c1
Sequence:CCGGGTCCGCATTTCACTATCATACCTCGAGGTATGATAGTGAAATGCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012092
ICOS MISSION shRNA Lentiviral Transduction Particles
inducible T-cell co-stimulator
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-508s1c1
Sequence:CCGGGCATACTTATTTGTTGGCTTACTCGAGTAAGCCAACAAATAAGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-481s1c1
Sequence:CCGGCCTTTGTTGTAGTCTGCATTTCTCGAGAAATGCAGACTACAACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-335s1c1
Sequence:CCGGCCATTCTCATGCCAACTATTACTCGAGTAATAGTTGGCATGAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-449s1c1
Sequence:CCGGGCTGAAGTTCTGGTTACCCATCTCGAGATGGGTAACCAGAACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012092.2-109s1c1
Sequence:CCGGCTGCCAATTATGAGATGTTTACTCGAGTAAACATCTCATAATTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012092.3-586s21c1
Sequence:CCGGGCACGACCCTAACGGTGAATACTCGAGTATTCACCGTTAGGGTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012092.3-649s21c1
Sequence:CCGGCACAGATGTGACCCTATAATACTCGAGTATTATAGGGTCACATCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012092.3-1066s21c1
Sequence:CCGGGTCCGCATTTCACTATCATACCTCGAGGTATGATAGTGAAATGCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017480
ICOS MISSION shRNA Bacterial Glycerol Stock
inducible T-cell co-stimulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-560s1c1
Sequence:CCGGCCAGTGTGCATGACCCTAATACTCGAGTATTAGGGTCATGCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-419s1c1
Sequence:CCGGGTGGAGGATATTTGCATATTTCTCGAGAAATATGCAAATATCCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-598s1c1
Sequence:CCGGGCGGCAGTCAACACAAACAAACTCGAGTTTGTTTGTGTTGACTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-306s1c1
Sequence:CCGGGTCAAACAACAGCGTCTCTTTCTCGAGAAAGAGACGCTGTTGTTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-139s1c1
Sequence:CCGGTCATTTCACAATGGAGGTGTACTCGAGTACACCTCCATTGTGAAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017480
ICOS MISSION shRNA shRNA Plasmid DNA
inducible T-cell co-stimulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-560s1c1
Sequence:CCGGCCAGTGTGCATGACCCTAATACTCGAGTATTAGGGTCATGCACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-419s1c1
Sequence:CCGGGTGGAGGATATTTGCATATTTCTCGAGAAATATGCAAATATCCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-598s1c1
Sequence:CCGGGCGGCAGTCAACACAAACAAACTCGAGTTTGTTTGTGTTGACTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-306s1c1
Sequence:CCGGGTCAAACAACAGCGTCTCTTTCTCGAGAAAGAGACGCTGTTGTTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-139s1c1
Sequence:CCGGTCATTTCACAATGGAGGTGTACTCGAGTACACCTCCATTGTGAAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017480
ICOS MISSION shRNA Lentiviral Transduction Particles
inducible T-cell co-stimulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-560s1c1
Sequence:CCGGCCAGTGTGCATGACCCTAATACTCGAGTATTAGGGTCATGCACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-419s1c1
Sequence:CCGGGTGGAGGATATTTGCATATTTCTCGAGAAATATGCAAATATCCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-598s1c1
Sequence:CCGGGCGGCAGTCAACACAAACAAACTCGAGTTTGTTTGTGTTGACTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-306s1c1
Sequence:CCGGGTCAAACAACAGCGTCTCTTTCTCGAGAAAGAGACGCTGTTGTTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017480.1-139s1c1
Sequence:CCGGTCATTTCACAATGGAGGTGTACTCGAGTACACCTCCATTGTGAAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)