EMAIL THIS PAGE TO A FRIEND

ICOSLG

inducible T-cell co-stimulator ligand

54 Gene Product Result for
Synonyms: B7-H2 B7H2 B7RP-1 B7RP1 CD275 GL50 ICOS-L ICOSL LICOS
UniProtKB ID: O75144, Q9HD18, Q9NRQ1
Gene ID:
Rat(499415) inducible T-cell co-stimulator ligand
sheep(101102203) inducible T-cell co-stimulator ligand
domestic guinea pig(100729325) inducible T-cell co-stimulator ligand
naked mole-rat(101726235) inducible T-cell co-stimulator ligand
chicken(395968) inducible T-cell co-stimulator ligand
dog(487793) inducible T-cell co-stimulator ligand
cow(507857) inducible T-cell co-stimulator ligand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1281 Human B7-H2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015259 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015259 Rosetta Predictions human pricing
XM_001079346 Rosetta Predictions rat pricing
XM_574731 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236521 predicted 1408
2 SASI_Hs01_00236522 predicted 1413
3 SASI_Hs02_00347408 predicted 1392
4 SASI_Hs01_00236523 predicted 1064
5 SASI_Hs01_00236524 predicted 507
6 SASI_Hs01_00236525 predicted 588
7 SASI_Hs01_00236526 predicted 334
8 SASI_Hs01_00236527 predicted 823
9 SASI_Hs01_00236528 predicted 817
10 SASI_Hs01_00236529 predicted 280
11 SASI_Hs01_00236530 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364091 predicted 794
2 SASI_Rn02_00364092 predicted 256
3 SASI_Rn02_00364093 predicted 684
4 SASI_Rn02_00364094 predicted 728
5 SASI_Rn02_00364095 predicted 282
6 SASI_Rn02_00364096 predicted 202
7 SASI_Rn02_00364097 predicted 301
8 SASI_Rn02_00364098 predicted 642
9 SASI_Rn02_00364099 predicted 346
10 SASI_Rn02_00364100 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402444 predicted 531
2 SASI_Rn02_00402445 predicted 518
3 SASI_Rn02_00402446 predicted 558
4 SASI_Rn02_00402447 predicted 557
5 SASI_Rn02_00402448 predicted 506
6 SASI_Rn02_00402449 predicted 529
7 SASI_Rn02_00402450 predicted 517
8 SASI_Rn02_00402451 predicted 558
9 SASI_Rn02_00402452 predicted 548
10 SASI_Rn02_00402453 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015259
ICOSLG MISSION shRNA Bacterial Glycerol Stock
inducible T-cell co-stimulator ligand
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015259.3-2300s1c1
Sequence:CCGGCCTCCTTCTTACTTCCCAGAACTCGAGTTCTGGGAAGTAAGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-620s1c1
Sequence:CCGGCCCAACGTGTACTGGATCAATCTCGAGATTGATCCAGTACACGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-673s1c1
Sequence:CCGGGCAGAATGACACCGTCTTCTTCTCGAGAAGAAGACGGTGTCATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-173s1c1
Sequence:CCGGGCTGATACTCAGGAGAAGGAACTCGAGTTCCTTCTCCTGAGTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-826s1c1
Sequence:CCGGCATCGGAGAGAGAGACAAGATCTCGAGATCTTGTCTCTCTCTCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015259
ICOSLG MISSION shRNA shRNA Plasmid DNA
inducible T-cell co-stimulator ligand
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015259.3-2300s1c1
Sequence:CCGGCCTCCTTCTTACTTCCCAGAACTCGAGTTCTGGGAAGTAAGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-620s1c1
Sequence:CCGGCCCAACGTGTACTGGATCAATCTCGAGATTGATCCAGTACACGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-673s1c1
Sequence:CCGGGCAGAATGACACCGTCTTCTTCTCGAGAAGAAGACGGTGTCATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-173s1c1
Sequence:CCGGGCTGATACTCAGGAGAAGGAACTCGAGTTCCTTCTCCTGAGTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-826s1c1
Sequence:CCGGCATCGGAGAGAGAGACAAGATCTCGAGATCTTGTCTCTCTCTCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015259
ICOSLG MISSION shRNA Lentiviral Transduction Particles
inducible T-cell co-stimulator ligand
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015259.3-2300s1c1
Sequence:CCGGCCTCCTTCTTACTTCCCAGAACTCGAGTTCTGGGAAGTAAGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-620s1c1
Sequence:CCGGCCCAACGTGTACTGGATCAATCTCGAGATTGATCCAGTACACGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-673s1c1
Sequence:CCGGGCAGAATGACACCGTCTTCTTCTCGAGAAGAAGACGGTGTCATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-173s1c1
Sequence:CCGGGCTGATACTCAGGAGAAGGAACTCGAGTTCCTTCTCCTGAGTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015259.3-826s1c1
Sequence:CCGGCATCGGAGAGAGAGACAAGATCTCGAGATCTTGTCTCTCTCTCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)