EMAIL THIS PAGE TO A FRIEND

ICT1

immature colon carcinoma transcript 1

60 Gene Product Result for
Synonyms: DS-1 DS1
UniProtKB ID: Q14197, B2RAD1, Q53HM7, Q53Y11
Gene ID:
Human(3396) Summary: The adult colon epithelium contains 3 differentiated cell types that arise from a multipotent stem cell. Deviation from the normal maturation pathway by neoplastic transformation is thought to initiate in stem cells or their early descendants. One potential marker is ICT1 whose mRNA and protein were more highly expressed in undifferentiated than in differentiated cells. [provided by RefSeq, Jul 2008]
Mouse(68572) immature colon carcinoma transcript 1
Rat(303673) immature colon carcinoma transcript 1
sheep(101123220) immature colon carcinoma transcript 1
domestic guinea pig(100728592) immature colon carcinoma transcript 1
naked mole-rat(101705469) immature colon carcinoma transcript 1
chicken(422114) immature colon carcinoma transcript 1
cow(515465) immature colon carcinoma transcript 1
dog(475911) immature colon carcinoma transcript 1
domestic cat(101097190) immature colon carcinoma transcript 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001545 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001545 Rosetta Predictions human pricing
XM_001081688 Rosetta Predictions rat pricing
XM_221110 Rosetta Predictions rat pricing
NM_026729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085203 predicted 214
2 SASI_Hs02_00332088 predicted 483
3 SASI_Hs02_00332089 predicted 569
4 SASI_Hs01_00085205 predicted 216
5 SASI_Hs02_00332090 predicted 565
6 SASI_Hs01_00085207 predicted 417
7 SASI_Hs01_00085208 predicted 288
8 SASI_Hs01_00085209 predicted 210
9 SASI_Hs01_00085211 predicted 224
10 SASI_Hs01_00085212 predicted 406
11 SASI_Hs01_00085204 predicted 531
12 SASI_Hs01_00085206 predicted 295
13 SASI_Hs01_00085210 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373021 predicted 220
2 SASI_Rn02_00373022 predicted 210
3 SASI_Rn02_00373023 predicted 430
4 SASI_Rn02_00373024 predicted 221
5 SASI_Rn02_00373025 predicted 534
6 SASI_Rn02_00373026 predicted 440
7 SASI_Rn02_00373027 predicted 226
8 SASI_Rn02_00373028 predicted 275
9 SASI_Rn02_00373029 predicted 216
10 SASI_Rn02_00373030 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379864 predicted 226
2 SASI_Rn02_00379865 predicted 207
3 SASI_Rn02_00379866 predicted 421
4 SASI_Rn02_00379867 predicted 226
5 SASI_Rn02_00379868 predicted 529
6 SASI_Rn02_00379869 predicted 437
7 SASI_Rn02_00379870 predicted 227
8 SASI_Rn02_00379871 predicted 269
9 SASI_Rn02_00379872 predicted 214
10 SASI_Rn02_00379873 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192043 predicted 309
2 SASI_Mm01_00192044 predicted 488
3 SASI_Mm01_00192045 predicted 333
4 SASI_Mm01_00192046 predicted 416
5 SASI_Mm01_00192047 predicted 356
6 SASI_Mm01_00192048 predicted 330
7 SASI_Mm01_00192049 predicted 336
8 SASI_Mm01_00192050 predicted 328
9 SASI_Mm01_00192051 predicted 217
10 SASI_Mm02_00330774 predicted 422
11 SASI_Mm01_00192042 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026729
ICT1 MISSION shRNA Bacterial Glycerol Stock
immature colon carcinoma transcript 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-361s1c1
Sequence:CCGGCTGGCAGAATGCCTACAGAAACTCGAGTTTCTGTAGGCATTCTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-139s1c1
Sequence:CCGGCCTCTGGATCGGTTAAGCATACTCGAGTATGCTTAACCGATCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-445s21c1
Sequence:CCGGCTTCAGAGACTCAGGATTGAACTCGAGTTCAATCCTGAGTCTCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-217s1c1
Sequence:CCGGGCTGAAGTAAGGTTTCACTTGCTCGAGCAAGTGAAACCTTACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-217s21c1
Sequence:CCGGGCTGAAGTAAGGTTTCACTTGCTCGAGCAAGTGAAACCTTACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-497s1c1
Sequence:CCGGGACTAAACTCTGCCCTAAAGACTCGAGTCTTTAGGGCAGAGTTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-445s1c1
Sequence:CCGGCTTCAGAGACTCAGGATTGAACTCGAGTTCAATCCTGAGTCTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-497s21c1
Sequence:CCGGGACTAAACTCTGCCCTAAAGACTCGAGTCTTTAGGGCAGAGTTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-148s21c1
Sequence:CCGGCGGTTAAGCATATCTTACTGTCTCGAGACAGTAAGATATGCTTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-148s1c1
Sequence:CCGGCGGTTAAGCATATCTTACTGTCTCGAGACAGTAAGATATGCTTAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026729
ICT1 MISSION shRNA shRNA Plasmid DNA
immature colon carcinoma transcript 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-361s1c1
Sequence:CCGGCTGGCAGAATGCCTACAGAAACTCGAGTTTCTGTAGGCATTCTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-139s1c1
Sequence:CCGGCCTCTGGATCGGTTAAGCATACTCGAGTATGCTTAACCGATCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-445s21c1
Sequence:CCGGCTTCAGAGACTCAGGATTGAACTCGAGTTCAATCCTGAGTCTCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-217s1c1
Sequence:CCGGGCTGAAGTAAGGTTTCACTTGCTCGAGCAAGTGAAACCTTACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-217s21c1
Sequence:CCGGGCTGAAGTAAGGTTTCACTTGCTCGAGCAAGTGAAACCTTACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-497s1c1
Sequence:CCGGGACTAAACTCTGCCCTAAAGACTCGAGTCTTTAGGGCAGAGTTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-445s1c1
Sequence:CCGGCTTCAGAGACTCAGGATTGAACTCGAGTTCAATCCTGAGTCTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-497s21c1
Sequence:CCGGGACTAAACTCTGCCCTAAAGACTCGAGTCTTTAGGGCAGAGTTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-148s21c1
Sequence:CCGGCGGTTAAGCATATCTTACTGTCTCGAGACAGTAAGATATGCTTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-148s1c1
Sequence:CCGGCGGTTAAGCATATCTTACTGTCTCGAGACAGTAAGATATGCTTAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026729
ICT1 MISSION shRNA Lentiviral Transduction Particles
immature colon carcinoma transcript 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-361s1c1
Sequence:CCGGCTGGCAGAATGCCTACAGAAACTCGAGTTTCTGTAGGCATTCTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-139s1c1
Sequence:CCGGCCTCTGGATCGGTTAAGCATACTCGAGTATGCTTAACCGATCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-445s21c1
Sequence:CCGGCTTCAGAGACTCAGGATTGAACTCGAGTTCAATCCTGAGTCTCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-217s1c1
Sequence:CCGGGCTGAAGTAAGGTTTCACTTGCTCGAGCAAGTGAAACCTTACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-217s21c1
Sequence:CCGGGCTGAAGTAAGGTTTCACTTGCTCGAGCAAGTGAAACCTTACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-497s1c1
Sequence:CCGGGACTAAACTCTGCCCTAAAGACTCGAGTCTTTAGGGCAGAGTTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-445s1c1
Sequence:CCGGCTTCAGAGACTCAGGATTGAACTCGAGTTCAATCCTGAGTCTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-497s21c1
Sequence:CCGGGACTAAACTCTGCCCTAAAGACTCGAGTCTTTAGGGCAGAGTTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026729.1-148s21c1
Sequence:CCGGCGGTTAAGCATATCTTACTGTCTCGAGACAGTAAGATATGCTTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026729.1-148s1c1
Sequence:CCGGCGGTTAAGCATATCTTACTGTCTCGAGACAGTAAGATATGCTTAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001545
VALIDATED
ICT1 MISSION shRNA Bacterial Glycerol Stock
immature colon carcinoma transcript 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-218s1c1
Sequence:CCGGCCCTCTAGATCGCTTGACAATCTCGAGATTGTCAAGCGATCTAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-380s1c1
Sequence:CCGGGATCAACAGGTTAGGAGAGTTCTCGAGAACTCTCCTAACCTGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-690s1c1
Sequence:CCGGCACCATAAGGAGATTTCTGTTCTCGAGAACAGAAATCTCCTTATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001545.1-235s1c1
Sequence:CCGGCAATATCTTATTGTCGGAGTACTCGAGTACTCCGACAATAAGATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-721s1c1
Sequence:CCGGGCTGTTAATGCTTGTCTATAACTCGAGTTATAGACAAGCATTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-269s1c1
Sequence:CCGGGCAGAATGTGAACAAAGTGAACTCGAGTTCACTTTGTTCACATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-225s1c1
Sequence:CCGGGATCGCTTGACAATATCTTATCTCGAGATAAGATATTGTCAAGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-351s1c1
Sequence:CCGGCAGAAGATAGCCATCACGCATCTCGAGATGCGTGATGGCTATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001545
VALIDATED
ICT1 MISSION shRNA shRNA Plasmid DNA
immature colon carcinoma transcript 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-218s1c1
Sequence:CCGGCCCTCTAGATCGCTTGACAATCTCGAGATTGTCAAGCGATCTAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-380s1c1
Sequence:CCGGGATCAACAGGTTAGGAGAGTTCTCGAGAACTCTCCTAACCTGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-690s1c1
Sequence:CCGGCACCATAAGGAGATTTCTGTTCTCGAGAACAGAAATCTCCTTATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001545.1-235s1c1
Sequence:CCGGCAATATCTTATTGTCGGAGTACTCGAGTACTCCGACAATAAGATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-721s1c1
Sequence:CCGGGCTGTTAATGCTTGTCTATAACTCGAGTTATAGACAAGCATTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-269s1c1
Sequence:CCGGGCAGAATGTGAACAAAGTGAACTCGAGTTCACTTTGTTCACATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-225s1c1
Sequence:CCGGGATCGCTTGACAATATCTTATCTCGAGATAAGATATTGTCAAGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-351s1c1
Sequence:CCGGCAGAAGATAGCCATCACGCATCTCGAGATGCGTGATGGCTATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001545
VALIDATED
ICT1 MISSION shRNA Lentiviral Transduction Particles
immature colon carcinoma transcript 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-218s1c1
Sequence:CCGGCCCTCTAGATCGCTTGACAATCTCGAGATTGTCAAGCGATCTAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-380s1c1
Sequence:CCGGGATCAACAGGTTAGGAGAGTTCTCGAGAACTCTCCTAACCTGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-690s1c1
Sequence:CCGGCACCATAAGGAGATTTCTGTTCTCGAGAACAGAAATCTCCTTATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001545.1-235s1c1
Sequence:CCGGCAATATCTTATTGTCGGAGTACTCGAGTACTCCGACAATAAGATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-721s1c1
Sequence:CCGGGCTGTTAATGCTTGTCTATAACTCGAGTTATAGACAAGCATTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-269s1c1
Sequence:CCGGGCAGAATGTGAACAAAGTGAACTCGAGTTCACTTTGTTCACATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-225s1c1
Sequence:CCGGGATCGCTTGACAATATCTTATCTCGAGATAAGATATTGTCAAGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001545.1-351s1c1
Sequence:CCGGCAGAAGATAGCCATCACGCATCTCGAGATGCGTGATGGCTATCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)