EMAIL THIS PAGE TO A FRIEND

ID1

inhibitor of DNA binding 1, dominant negative helix-loop-helix protein

86 Gene Product Result for
Synonyms: ID bHLHb24
Gene ID:
Human(3397) Summary: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15901) inhibitor of DNA binding 1
Rat(25261) inhibitor of DNA binding 1
Zebrafish(30493) inhibitor of DNA binding 1
cow(497011) inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
domestic cat(101097058) inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
dog(609779) inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
chicken(395282) inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
domestic guinea pig(100734662) inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
naked mole-rat(101714583) inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
sheep(101111650) inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100256 Anti-ID1 (106-120) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405981 Anti-ID1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2101121 Anti-ID1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA051456 Anti-ID1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA058518 Anti-ID1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0003397M2 Monoclonal Anti-ID1 antibody produced in mouse clone 1F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403956 Monoclonal Anti-ID1 antibody produced in mouse clone 4G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409220 Monoclonal Anti-ID1 antibody produced in mouse clone 4D7-1A2, ascites fluid, solution human
ELISA, western blot pricing
SAB1409221 Monoclonal Anti-ID1 antibody produced in mouse clone 5D9, ascites fluid, solution human
ELISA, western blot pricing
SAB1409222 Monoclonal Anti-ID1 antibody produced in mouse clone 1D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409223 Monoclonal Anti-ID1 antibody produced in mouse clone 3F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409224 Monoclonal Anti-ID1 antibody produced in mouse clone 3F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409225 Monoclonal Anti-ID1 antibody produced in mouse clone 4F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409226 Monoclonal Anti-ID1 antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409227 Monoclonal Anti-ID1 antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409228 Monoclonal Anti-ID1 antibody produced in mouse clone 3A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409229 Monoclonal Anti-ID1 antibody produced in mouse clone 1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409230 Monoclonal Anti-ID1 antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002165 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002165 Rosetta Predictions human pricing
NM_181353 Rosetta Predictions human pricing
NM_012797 Rosetta Predictions rat pricing
NM_010495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246328 predicted 749
2 SASI_Hs01_00246329 predicted 738
3 SASI_Hs01_00246330 predicted 754
4 SASI_Hs01_00246331 predicted 748
5 SASI_Hs01_00246332 predicted 734
6 SASI_Hs01_00246333 predicted 754
7 SASI_Hs01_00246334 predicted 754
8 SASI_Hs01_00246335 predicted 647
9 SASI_Hs01_00246336 predicted 425
10 SASI_Hs01_00246337 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057899 predicted 988
2 SASI_Hs01_00057900 predicted 980
3 SASI_Hs01_00057901 predicted 997
4 SASI_Hs01_00057902 predicted 980
5 SASI_Hs01_00057903 predicted 972
6 SASI_Hs01_00057904 predicted 994
7 SASI_Hs01_00057905 predicted 991
8 SASI_Hs01_00057906 predicted 735
9 SASI_Hs01_00057907 predicted 428
10 SASI_Hs01_00057908 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097036 predicted 307
2 SASI_Rn01_00097037 predicted 274
3 SASI_Rn01_00097038 predicted 206
4 SASI_Rn01_00097039 predicted 311
5 SASI_Rn01_00097040 predicted 306
6 SASI_Rn02_00260225 predicted 281
7 SASI_Rn01_00097041 predicted 360
8 SASI_Rn01_00097043 predicted 480
9 SASI_Rn01_00097044 predicted 465
10 SASI_Rn01_00097045 predicted 244
11 SASI_Rn01_00097042 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162260 predicted 517
2 SASI_Mm01_00162261 predicted 317
3 SASI_Mm01_00162262 predicted 327
4 SASI_Mm01_00162263 predicted 472
5 SASI_Mm01_00162264 predicted 317
6 SASI_Mm01_00162265 predicted 488
7 SASI_Mm01_00162266 predicted 366
8 SASI_Mm01_00162267 predicted 331
9 SASI_Mm01_00162268 predicted 524
10 SASI_Mm01_00162269 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010495
VALIDATED
ID1 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-230s21c1
Sequence:CCGGGTGAACGTCCTGCTCTACGACCTCGAGGTCGTAGAGCAGGACGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010495.2-299s21c1
Sequence:CCGGCAGAACCGCAAAGTGAGCAAGCTCGAGCTTGCTCACTTTGCGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-648s21c1
Sequence:CCGGGGTAGAGGGTTTGATCAACAGCTCGAGCTGTTGATCAAACCCTCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-368s21c1
Sequence:CCGGGAGCTGAACTCGGAGTCTGAACTCGAGTTCAGACTCCGAGTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-331s1c1
Sequence:CCGGGCAGCATGTAATCGACTACATCTCGAGATGTAGTCGATTACATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-256s1c1
Sequence:CCGGCGGCTGCTACTCACGCCTCAACTCGAGTTGAGGCGTGAGTAGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-141s1c1
Sequence:CCGGGCGAGGTGGTACTTGGTCTGTCTCGAGACAGACCAAGTACCACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010495.1-103s1c1
Sequence:CCGGAGGCCCTAGCTGTTCGCTGAACTCGAGTTCAGCGAACAGCTAGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-476s1c1
Sequence:CCGGGCATGTGTTCCAGCCGACGATCTCGAGATCGTCGGCTGGAACACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010495
VALIDATED
ID1 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-230s21c1
Sequence:CCGGGTGAACGTCCTGCTCTACGACCTCGAGGTCGTAGAGCAGGACGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010495.2-299s21c1
Sequence:CCGGCAGAACCGCAAAGTGAGCAAGCTCGAGCTTGCTCACTTTGCGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-648s21c1
Sequence:CCGGGGTAGAGGGTTTGATCAACAGCTCGAGCTGTTGATCAAACCCTCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-368s21c1
Sequence:CCGGGAGCTGAACTCGGAGTCTGAACTCGAGTTCAGACTCCGAGTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-331s1c1
Sequence:CCGGGCAGCATGTAATCGACTACATCTCGAGATGTAGTCGATTACATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-256s1c1
Sequence:CCGGCGGCTGCTACTCACGCCTCAACTCGAGTTGAGGCGTGAGTAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-141s1c1
Sequence:CCGGGCGAGGTGGTACTTGGTCTGTCTCGAGACAGACCAAGTACCACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010495.1-103s1c1
Sequence:CCGGAGGCCCTAGCTGTTCGCTGAACTCGAGTTCAGCGAACAGCTAGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-476s1c1
Sequence:CCGGGCATGTGTTCCAGCCGACGATCTCGAGATCGTCGGCTGGAACACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010495
VALIDATED
ID1 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-230s21c1
Sequence:CCGGGTGAACGTCCTGCTCTACGACCTCGAGGTCGTAGAGCAGGACGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010495.2-299s21c1
Sequence:CCGGCAGAACCGCAAAGTGAGCAAGCTCGAGCTTGCTCACTTTGCGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-648s21c1
Sequence:CCGGGGTAGAGGGTTTGATCAACAGCTCGAGCTGTTGATCAAACCCTCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010495.2-368s21c1
Sequence:CCGGGAGCTGAACTCGGAGTCTGAACTCGAGTTCAGACTCCGAGTTCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-331s1c1
Sequence:CCGGGCAGCATGTAATCGACTACATCTCGAGATGTAGTCGATTACATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-256s1c1
Sequence:CCGGCGGCTGCTACTCACGCCTCAACTCGAGTTGAGGCGTGAGTAGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-141s1c1
Sequence:CCGGGCGAGGTGGTACTTGGTCTGTCTCGAGACAGACCAAGTACCACCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010495.1-103s1c1
Sequence:CCGGAGGCCCTAGCTGTTCGCTGAACTCGAGTTCAGCGAACAGCTAGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010495.1-476s1c1
Sequence:CCGGGCATGTGTTCCAGCCGACGATCTCGAGATCGTCGGCTGGAACACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002165
VALIDATED
ID1 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-297s21c1
Sequence:CCGGCTACGACATGAACGGCTGTTACTCGAGTAACAGCCGTTCATGTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-396s21c1
Sequence:CCGGCGACTACATCAGGGACCTTCACTCGAGTGAAGGTCCCTGATGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002165.2-765s21c1
Sequence:CCGGCCTACTAGTCACCAGAGACTTCTCGAGAAGTCTCTGGTGACTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-548s21c1
Sequence:CCGGATCGCATCTTGTGTCGCTGAACTCGAGTTCAGCGACACAAGATGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002165.2-765s1c1
Sequence:CCGGCCTACTAGTCACCAGAGACTTCTCGAGAAGTCTCTGGTGACTAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-428s1c1
Sequence:CCGGACTCGGAATCCGAAGTTGGAACTCGAGTTCCAACTTCGGATTCCGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-279s1c1
Sequence:CCGGGCAGGTAAACGTGCTGCTCTACTCGAGTAGAGCAGCACGTTTACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-309s1c1
Sequence:CCGGCGGCTGTTACTCACGCCTCAACTCGAGTTGAGGCGTGAGTAACAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002165
VALIDATED
ID1 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-297s21c1
Sequence:CCGGCTACGACATGAACGGCTGTTACTCGAGTAACAGCCGTTCATGTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-396s21c1
Sequence:CCGGCGACTACATCAGGGACCTTCACTCGAGTGAAGGTCCCTGATGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002165.2-765s21c1
Sequence:CCGGCCTACTAGTCACCAGAGACTTCTCGAGAAGTCTCTGGTGACTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-548s21c1
Sequence:CCGGATCGCATCTTGTGTCGCTGAACTCGAGTTCAGCGACACAAGATGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002165.2-765s1c1
Sequence:CCGGCCTACTAGTCACCAGAGACTTCTCGAGAAGTCTCTGGTGACTAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-428s1c1
Sequence:CCGGACTCGGAATCCGAAGTTGGAACTCGAGTTCCAACTTCGGATTCCGAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-279s1c1
Sequence:CCGGGCAGGTAAACGTGCTGCTCTACTCGAGTAGAGCAGCACGTTTACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-309s1c1
Sequence:CCGGCGGCTGTTACTCACGCCTCAACTCGAGTTGAGGCGTGAGTAACAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002165
VALIDATED
ID1 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-297s21c1
Sequence:CCGGCTACGACATGAACGGCTGTTACTCGAGTAACAGCCGTTCATGTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-396s21c1
Sequence:CCGGCGACTACATCAGGGACCTTCACTCGAGTGAAGGTCCCTGATGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002165.2-765s21c1
Sequence:CCGGCCTACTAGTCACCAGAGACTTCTCGAGAAGTCTCTGGTGACTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002165.2-548s21c1
Sequence:CCGGATCGCATCTTGTGTCGCTGAACTCGAGTTCAGCGACACAAGATGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002165.2-765s1c1
Sequence:CCGGCCTACTAGTCACCAGAGACTTCTCGAGAAGTCTCTGGTGACTAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-428s1c1
Sequence:CCGGACTCGGAATCCGAAGTTGGAACTCGAGTTCCAACTTCGGATTCCGAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-279s1c1
Sequence:CCGGGCAGGTAAACGTGCTGCTCTACTCGAGTAGAGCAGCACGTTTACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002165.2-309s1c1
Sequence:CCGGCGGCTGTTACTCACGCCTCAACTCGAGTTGAGGCGTGAGTAACAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)