EMAIL THIS PAGE TO A FRIEND

ID2

inhibitor of DNA binding 2, dominant negative helix-loop-helix protein

82 Gene Product Result for
Synonyms: GIG8 ID2A ID2H bHLHb26
UniProtKB ID: Q02363
Gene ID:
Human(3398) Summary: The protein encoded by this gene belongs to the inhibitor of DNA binding family, members of which are transcriptional regulators that contain a helix-loop-helix (HLH) domain but not a basic domain. Members of the inhibitor of DNA binding family inhibit the functions of basic helix-loop-helix transcription factors in a dominant-negative manner by suppressing their heterodimerization partners through the HLH domains. This protein may play a role in negatively regulating cell differentiation. A pseudogene of this gene is located on chromosome 3. [provided by RefSeq, Aug 2011]
Mouse(15902) inhibitor of DNA binding 2
Rat(25587) inhibitor of DNA binding 2
sheep(101115522) inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
domestic guinea pig(100729886) inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
naked mole-rat(101708071) inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
chicken(395852) inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
cow(505025) inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
domestic cat(101090256) inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002166 Rosetta Predictions human pricing
NM_013060 Rosetta Predictions rat pricing
NM_010496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200907 predicted 267
2 SASI_Hs01_00200908 predicted 344
3 SASI_Hs01_00200909 predicted 278
4 SASI_Hs01_00200910 predicted 274
5 SASI_Hs01_00200911 predicted 272
6 SASI_Hs01_00200912 predicted 338
7 SASI_Hs01_00200913 predicted 265
8 SASI_Hs01_00200914 predicted 781
9 SASI_Hs01_00200915 predicted 751
10 SASI_Hs01_00200916 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119865 predicted 254
2 SASI_Rn01_00119866 predicted 254
3 SASI_Rn01_00119867 predicted 251
4 SASI_Rn01_00119868 predicted 254
5 SASI_Rn01_00119869 predicted 221
6 SASI_Rn01_00119871 predicted 248
7 SASI_Rn01_00119872 predicted 266
8 SASI_Rn01_00119873 predicted 249
9 SASI_Rn01_00119874 predicted 229
10 SASI_Rn02_00260797 predicted 222
11 SASI_Rn01_00119870 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142448 predicted 276
2 SASI_Mm01_00142449 predicted 278
3 SASI_Mm01_00142450 predicted 266
4 SASI_Mm02_00318745 predicted 195
5 SASI_Mm01_00142451 predicted 243
6 SASI_Mm02_00318746 predicted 194
7 SASI_Mm01_00142452 predicted 277
8 SASI_Mm02_00318747 predicted 197
9 SASI_Mm02_00318748 predicted 197
10 SASI_Mm01_00142453 predicted 244
11 SASI_Mm01_00142454 predicted 224
12 SASI_Mm01_00142455 predicted 252
13 SASI_Mm01_00142456 predicted 236
14 SASI_Mm01_00142457 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002166
VALIDATED
ID2 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-1015s1c1
Sequence:CCGGGCCTACTGAATGCTGTGTATACTCGAGTATACACAGCATTCAGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002166.4-345s1c1
Sequence:CCGGCCAGAACAAGAAGGTGAGCAACTCGAGTTGCTCACCTTCTTGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-543s1c1
Sequence:CCGGCCCTTCTGAGTTAATGTCAAACTCGAGTTTGACATTAACTCAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002166.4-282s1c1
Sequence:CCGGGAGCCTGCTATACAACATGAACTCGAGTTCATGTTGTATAGCAGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-430s1c1
Sequence:CCGGCCCACTATTGTCAGCCTGCATCTCGAGATGCAGGCTGACAATAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-780s21c1
Sequence:CCGGTGGACTGTGATATTCGTTATTCTCGAGAATAACGAATATCACAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-573s21c1
Sequence:CCGGAGCACTGTGTGGCTGAATAAGCTCGAGCTTATTCAGCCACACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002166.4-544s21c1
Sequence:CCGGCCTTCTGAGTTAATGTCAAATCTCGAGATTTGACATTAACTCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-492s21c1
Sequence:CCGGGACCACCCTCAACACGGATATCTCGAGATATCCGTGTTGAGGGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002166.4-419s21c1
Sequence:CCGGTGGACTCGCATCCCACTATTGCTCGAGCAATAGTGGGATGCGAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002166
VALIDATED
ID2 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-1015s1c1
Sequence:CCGGGCCTACTGAATGCTGTGTATACTCGAGTATACACAGCATTCAGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002166.4-345s1c1
Sequence:CCGGCCAGAACAAGAAGGTGAGCAACTCGAGTTGCTCACCTTCTTGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-543s1c1
Sequence:CCGGCCCTTCTGAGTTAATGTCAAACTCGAGTTTGACATTAACTCAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002166.4-282s1c1
Sequence:CCGGGAGCCTGCTATACAACATGAACTCGAGTTCATGTTGTATAGCAGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-430s1c1
Sequence:CCGGCCCACTATTGTCAGCCTGCATCTCGAGATGCAGGCTGACAATAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-780s21c1
Sequence:CCGGTGGACTGTGATATTCGTTATTCTCGAGAATAACGAATATCACAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-573s21c1
Sequence:CCGGAGCACTGTGTGGCTGAATAAGCTCGAGCTTATTCAGCCACACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002166.4-544s21c1
Sequence:CCGGCCTTCTGAGTTAATGTCAAATCTCGAGATTTGACATTAACTCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-492s21c1
Sequence:CCGGGACCACCCTCAACACGGATATCTCGAGATATCCGTGTTGAGGGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002166.4-419s21c1
Sequence:CCGGTGGACTCGCATCCCACTATTGCTCGAGCAATAGTGGGATGCGAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002166
VALIDATED
ID2 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-1015s1c1
Sequence:CCGGGCCTACTGAATGCTGTGTATACTCGAGTATACACAGCATTCAGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002166.4-345s1c1
Sequence:CCGGCCAGAACAAGAAGGTGAGCAACTCGAGTTGCTCACCTTCTTGTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-543s1c1
Sequence:CCGGCCCTTCTGAGTTAATGTCAAACTCGAGTTTGACATTAACTCAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002166.4-282s1c1
Sequence:CCGGGAGCCTGCTATACAACATGAACTCGAGTTCATGTTGTATAGCAGGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002166.4-430s1c1
Sequence:CCGGCCCACTATTGTCAGCCTGCATCTCGAGATGCAGGCTGACAATAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-780s21c1
Sequence:CCGGTGGACTGTGATATTCGTTATTCTCGAGAATAACGAATATCACAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-573s21c1
Sequence:CCGGAGCACTGTGTGGCTGAATAAGCTCGAGCTTATTCAGCCACACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002166.4-544s21c1
Sequence:CCGGCCTTCTGAGTTAATGTCAAATCTCGAGATTTGACATTAACTCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002166.4-492s21c1
Sequence:CCGGGACCACCCTCAACACGGATATCTCGAGATATCCGTGTTGAGGGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002166.4-419s21c1
Sequence:CCGGTGGACTCGCATCCCACTATTGCTCGAGCAATAGTGGGATGCGAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010496
VALIDATED
ID2 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-420s1c1
Sequence:CCGGCCTTCTGAGCTTATGTCGAATCTCGAGATTCGACATAAGCTCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-428s1c1
Sequence:CCGGGCTTATGTCGAATGATAGCAACTCGAGTTGCTATCATTCGACATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-257s1c1
Sequence:CCGGGCACGTCATCGATTACATCTTCTCGAGAAGATGTAATCGATGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-306s1c1
Sequence:CCGGCCCACTATCGTCAGCCTGCATCTCGAGATGCAGGCTGACGATAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-221s1c1
Sequence:CCGGCCAGAACAAGAAGGTGACCAACTCGAGTTGGTCACCTTCTTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-398s21c1
Sequence:CCGGCTGAACACGGACATCAGCATCCTCGAGGATGCTGATGTCCGTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-448s21c1
Sequence:GTACCGGTGAGCTTATGTCGAATGATAGCTCGAGCTATCATTCGACATAAGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010496.3-683s21c1
Sequence:CCGGTGGACTGTGATACCGTTATTTCTCGAGAAATAACGGTATCACAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-472s21c1
Sequence:CCGGAGTACTCTGTGGCTAAATAAACTCGAGTTTATTTAGCCACAGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-253s21c1
Sequence:CCGGGAAGGTGACCAAGATGGAAATCTCGAGATTTCCATCTTGGTCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-202s21c1
Sequence:CCGGCGACTGCTACTCCAAGCTCAACTCGAGTTGAGCTTGGAGTAGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-140s21c1
Sequence:CCGGTTGGGCATCTCCCGGAGCAAACTCGAGTTTGCTCCGGGAGATGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-420s21c1
Sequence:CCGGTGTCCTTGCAGGCATCTGAATCTCGAGATTCAGATGCCTGCAAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010496
VALIDATED
ID2 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-420s1c1
Sequence:CCGGCCTTCTGAGCTTATGTCGAATCTCGAGATTCGACATAAGCTCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-428s1c1
Sequence:CCGGGCTTATGTCGAATGATAGCAACTCGAGTTGCTATCATTCGACATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-257s1c1
Sequence:CCGGGCACGTCATCGATTACATCTTCTCGAGAAGATGTAATCGATGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-306s1c1
Sequence:CCGGCCCACTATCGTCAGCCTGCATCTCGAGATGCAGGCTGACGATAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-221s1c1
Sequence:CCGGCCAGAACAAGAAGGTGACCAACTCGAGTTGGTCACCTTCTTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-398s21c1
Sequence:CCGGCTGAACACGGACATCAGCATCCTCGAGGATGCTGATGTCCGTGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-448s21c1
Sequence:GTACCGGTGAGCTTATGTCGAATGATAGCTCGAGCTATCATTCGACATAAGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010496.3-683s21c1
Sequence:CCGGTGGACTGTGATACCGTTATTTCTCGAGAAATAACGGTATCACAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-472s21c1
Sequence:CCGGAGTACTCTGTGGCTAAATAAACTCGAGTTTATTTAGCCACAGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-253s21c1
Sequence:CCGGGAAGGTGACCAAGATGGAAATCTCGAGATTTCCATCTTGGTCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-202s21c1
Sequence:CCGGCGACTGCTACTCCAAGCTCAACTCGAGTTGAGCTTGGAGTAGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-140s21c1
Sequence:CCGGTTGGGCATCTCCCGGAGCAAACTCGAGTTTGCTCCGGGAGATGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-420s21c1
Sequence:CCGGTGTCCTTGCAGGCATCTGAATCTCGAGATTCAGATGCCTGCAAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010496
VALIDATED
ID2 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-420s1c1
Sequence:CCGGCCTTCTGAGCTTATGTCGAATCTCGAGATTCGACATAAGCTCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-428s1c1
Sequence:CCGGGCTTATGTCGAATGATAGCAACTCGAGTTGCTATCATTCGACATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-257s1c1
Sequence:CCGGGCACGTCATCGATTACATCTTCTCGAGAAGATGTAATCGATGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-306s1c1
Sequence:CCGGCCCACTATCGTCAGCCTGCATCTCGAGATGCAGGCTGACGATAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010496.2-221s1c1
Sequence:CCGGCCAGAACAAGAAGGTGACCAACTCGAGTTGGTCACCTTCTTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-398s21c1
Sequence:CCGGCTGAACACGGACATCAGCATCCTCGAGGATGCTGATGTCCGTGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-448s21c1
Sequence:GTACCGGTGAGCTTATGTCGAATGATAGCTCGAGCTATCATTCGACATAAGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010496.3-683s21c1
Sequence:CCGGTGGACTGTGATACCGTTATTTCTCGAGAAATAACGGTATCACAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-472s21c1
Sequence:CCGGAGTACTCTGTGGCTAAATAAACTCGAGTTTATTTAGCCACAGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010496.3-253s21c1
Sequence:CCGGGAAGGTGACCAAGATGGAAATCTCGAGATTTCCATCTTGGTCACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-202s21c1
Sequence:CCGGCGACTGCTACTCCAAGCTCAACTCGAGTTGAGCTTGGAGTAGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-140s21c1
Sequence:CCGGTTGGGCATCTCCCGGAGCAAACTCGAGTTTGCTCCGGGAGATGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010496.3-420s21c1
Sequence:CCGGTGTCCTTGCAGGCATCTGAATCTCGAGATTCAGATGCCTGCAAGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)