EMAIL THIS PAGE TO A FRIEND

ID3

inhibitor of DNA binding 3, dominant negative helix-loop-helix protein

66 Gene Product Result for
Synonyms: HEIR-1 bHLHb25
UniProtKB ID: Q02535, A8K1T8, O75641
Gene ID:
Human(3399) Summary: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. [provided by RefSeq, Aug 2011]
Mouse(15903) inhibitor of DNA binding 3
Rat(25585) inhibitor of DNA binding 3
Zebrafish(246093) inhibitor of DNA binding 3
cow(538690) inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
domestic cat(101098313) inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
dog(403547) inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
chicken(395281) inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
domestic guinea pig(100714404) inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
naked mole-rat(101712383) inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
sheep(100415775) inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409231 Anti-ID3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412352 ANTI-ID3 antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412646 ANTI-ID3 antibody produced in mouse clone 3D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2107884 Anti-ID3 antibody produced in rabbit IgG fraction of antiserum horse, dog, rabbit, human, pig
western blot pricing
SAB2108387 Anti-ID3 antibody produced in rabbit affinity isolated antibody pig, sheep, bovine, mouse, rabbit, rat, human, dog
western blot pricing
AV32335 Anti-ID3 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder bovine, rat, canine, pig, mouse, human
western blot pricing
HPA024677 Anti-ID3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106258 Anti-ID3 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, horse, rat, rabbit
ELISA, western blot pricing
WH0003399M1 Monoclonal Anti-ID3 antibody produced in mouse clone 4G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2702151 Monoclonal Anti-ID3 antibody produced in mouse mouse, human
immunocytochemistry, immunofluorescence, immunoprecipitation (IP) pricing
SAB1403958 Monoclonal Anti-ID3, (N-terminal) antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002167 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002167 Rosetta Predictions human pricing
NM_013058 Rosetta Predictions rat pricing
NM_008321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069405 predicted 587
2 SASI_Hs02_00333376 predicted 1020
3 SASI_Hs01_00069406 predicted 511
4 SASI_Hs01_00069407 predicted 717
5 SASI_Hs02_00333377 predicted 710
6 SASI_Hs01_00069411 predicted 623
7 SASI_Hs02_00333378 predicted 437
8 SASI_Hs02_00333379 predicted 877
9 SASI_Hs02_00333380 predicted 872
10 SASI_Hs02_00333381 predicted 927
11 SASI_Hs01_00069402 predicted 894
12 SASI_Hs01_00069403 predicted 906
13 SASI_Hs01_00069404 predicted 682
14 SASI_Hs01_00069408 predicted 844
15 SASI_Hs01_00069409 predicted 466
16 SASI_Hs01_00069410 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076399 predicted 266
2 SASI_Rn01_00076400 predicted 347
3 SASI_Rn01_00076401 predicted 621
4 SASI_Rn01_00076402 predicted 494
5 SASI_Rn01_00076403 predicted 337
6 SASI_Rn01_00076405 predicted 340
7 SASI_Rn01_00076406 predicted 578
8 SASI_Rn02_00260794 predicted 541
9 SASI_Rn01_00076407 predicted 256
10 SASI_Rn01_00076408 predicted 340
11 SASI_Rn01_00076404 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027883 predicted 513
2 SASI_Mm01_00027884 predicted 634
3 SASI_Mm01_00027885 predicted 367
4 SASI_Mm01_00027886 predicted 513
5 SASI_Mm01_00027887 predicted 630
6 SASI_Mm01_00027888 predicted 514
7 SASI_Mm01_00027889 predicted 359
8 SASI_Mm01_00027890 predicted 544
9 SASI_Mm01_00027891 predicted 290
10 SASI_Mm01_00027892 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008321
VALIDATED
ID3 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008321.2-517s21c1
Sequence:CCGGATGGATGAGCTTCGATCTTAACTCGAGTTAAGATCGAAGCTCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-361s21c1
Sequence:CCGGGCTGAGCTCACTCCGGAACTTCTCGAGAAGTTCCGGAGTGAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-168s21c1
Sequence:CCGGTCTTAGCCTCTTGGACGACATCTCGAGATGTCGTCCAAGAGGCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-361s1c1
Sequence:CCGGGCTGAGCTCACTCCGGAACTTCTCGAGAAGTTCCGGAGTGAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-259s1c1
Sequence:CCGGGAAATCCTGCAGCGTGTCATACTCGAGTATGACACGCTGCAGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-267s1c1
Sequence:CCGGGCAGCGTGTCATAGACTACATCTCGAGATGTAGTCTATGACACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-168s1c1
Sequence:CCGGTCTTAGCCTCTTGGACGACATCTCGAGATGTCGTCCAAGAGGCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008321.1-94s1c1
Sequence:CCGGGCGGTGTGCTGCCTGTCGGAACTCGAGTTCCGACAGGCAGCACACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-388s21c1
Sequence:CCGGTCCAAGGACAAGAGGAGCTTTCTCGAGAAAGCTCCTCTTGTCCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008321
VALIDATED
ID3 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008321.2-517s21c1
Sequence:CCGGATGGATGAGCTTCGATCTTAACTCGAGTTAAGATCGAAGCTCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-361s21c1
Sequence:CCGGGCTGAGCTCACTCCGGAACTTCTCGAGAAGTTCCGGAGTGAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-168s21c1
Sequence:CCGGTCTTAGCCTCTTGGACGACATCTCGAGATGTCGTCCAAGAGGCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-361s1c1
Sequence:CCGGGCTGAGCTCACTCCGGAACTTCTCGAGAAGTTCCGGAGTGAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-259s1c1
Sequence:CCGGGAAATCCTGCAGCGTGTCATACTCGAGTATGACACGCTGCAGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-267s1c1
Sequence:CCGGGCAGCGTGTCATAGACTACATCTCGAGATGTAGTCTATGACACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-168s1c1
Sequence:CCGGTCTTAGCCTCTTGGACGACATCTCGAGATGTCGTCCAAGAGGCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008321.1-94s1c1
Sequence:CCGGGCGGTGTGCTGCCTGTCGGAACTCGAGTTCCGACAGGCAGCACACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-388s21c1
Sequence:CCGGTCCAAGGACAAGAGGAGCTTTCTCGAGAAAGCTCCTCTTGTCCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008321
VALIDATED
ID3 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008321.2-517s21c1
Sequence:CCGGATGGATGAGCTTCGATCTTAACTCGAGTTAAGATCGAAGCTCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-361s21c1
Sequence:CCGGGCTGAGCTCACTCCGGAACTTCTCGAGAAGTTCCGGAGTGAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-168s21c1
Sequence:CCGGTCTTAGCCTCTTGGACGACATCTCGAGATGTCGTCCAAGAGGCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-361s1c1
Sequence:CCGGGCTGAGCTCACTCCGGAACTTCTCGAGAAGTTCCGGAGTGAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-259s1c1
Sequence:CCGGGAAATCCTGCAGCGTGTCATACTCGAGTATGACACGCTGCAGGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-267s1c1
Sequence:CCGGGCAGCGTGTCATAGACTACATCTCGAGATGTAGTCTATGACACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008321.1-168s1c1
Sequence:CCGGTCTTAGCCTCTTGGACGACATCTCGAGATGTCGTCCAAGAGGCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008321.1-94s1c1
Sequence:CCGGGCGGTGTGCTGCCTGTCGGAACTCGAGTTCCGACAGGCAGCACACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008321.2-388s21c1
Sequence:CCGGTCCAAGGACAAGAGGAGCTTTCTCGAGAAAGCTCCTCTTGTCCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002167
VALIDATED
ID3 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-529s21c1
Sequence:CCGGGACGACATGAACCACTGCTACCTCGAGGTAGCAGTGGTTCATGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002167.3-714s21c1
Sequence:CCGGGCTCACTCCGGAACTTGTCATCTCGAGATGACAAGTTCCGGAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002167.3-881s21c1
Sequence:CCGGGCCCACTTGACTTCACCAAATCTCGAGATTTGGTGAAGTCAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-634s21c1
Sequence:CCGGATTCTCGACCTGCAGGTAGTCCTCGAGGACTACCTGCAGGTCGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-700s21c1
Sequence:CCGGATCCAGACAGCCGAGCTCACTCTCGAGAGTGAGCTCGGCTGTCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002167.2-843s1c1
Sequence:CCGGGCCCACTTGACTTCACCAAATCTCGAGATTTGGTGAAGTCAAGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002167.2-553s1c1
Sequence:CCGGTCAGCTTAGCCAGGTGGAAATCTCGAGATTTCCACCTGGCTAAGCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002167.2-586s1c1
Sequence:CCGGCATCGACTACATTCTCGACCTCTCGAGAGGTCGAGAATGTAGTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002167.2-477s1c1
Sequence:CCGGCGCTGAGCTTGCTGGACGACACTCGAGTGTCGTCCAGCAAGCTCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002167
VALIDATED
ID3 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-529s21c1
Sequence:CCGGGACGACATGAACCACTGCTACCTCGAGGTAGCAGTGGTTCATGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002167.3-714s21c1
Sequence:CCGGGCTCACTCCGGAACTTGTCATCTCGAGATGACAAGTTCCGGAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002167.3-881s21c1
Sequence:CCGGGCCCACTTGACTTCACCAAATCTCGAGATTTGGTGAAGTCAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-634s21c1
Sequence:CCGGATTCTCGACCTGCAGGTAGTCCTCGAGGACTACCTGCAGGTCGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-700s21c1
Sequence:CCGGATCCAGACAGCCGAGCTCACTCTCGAGAGTGAGCTCGGCTGTCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002167.2-843s1c1
Sequence:CCGGGCCCACTTGACTTCACCAAATCTCGAGATTTGGTGAAGTCAAGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002167.2-553s1c1
Sequence:CCGGTCAGCTTAGCCAGGTGGAAATCTCGAGATTTCCACCTGGCTAAGCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002167.2-586s1c1
Sequence:CCGGCATCGACTACATTCTCGACCTCTCGAGAGGTCGAGAATGTAGTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002167.2-477s1c1
Sequence:CCGGCGCTGAGCTTGCTGGACGACACTCGAGTGTCGTCCAGCAAGCTCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002167
VALIDATED
ID3 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-529s21c1
Sequence:CCGGGACGACATGAACCACTGCTACCTCGAGGTAGCAGTGGTTCATGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002167.3-714s21c1
Sequence:CCGGGCTCACTCCGGAACTTGTCATCTCGAGATGACAAGTTCCGGAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002167.3-881s21c1
Sequence:CCGGGCCCACTTGACTTCACCAAATCTCGAGATTTGGTGAAGTCAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-634s21c1
Sequence:CCGGATTCTCGACCTGCAGGTAGTCCTCGAGGACTACCTGCAGGTCGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002167.3-700s21c1
Sequence:CCGGATCCAGACAGCCGAGCTCACTCTCGAGAGTGAGCTCGGCTGTCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002167.2-843s1c1
Sequence:CCGGGCCCACTTGACTTCACCAAATCTCGAGATTTGGTGAAGTCAAGTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002167.2-553s1c1
Sequence:CCGGTCAGCTTAGCCAGGTGGAAATCTCGAGATTTCCACCTGGCTAAGCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002167.2-586s1c1
Sequence:CCGGCATCGACTACATTCTCGACCTCTCGAGAGGTCGAGAATGTAGTCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002167.2-477s1c1
Sequence:CCGGCGCTGAGCTTGCTGGACGACACTCGAGTGTCGTCCAGCAAGCTCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)