EMAIL THIS PAGE TO A FRIEND

ID4

inhibitor of DNA binding 4, dominant negative helix-loop-helix protein

92 Gene Product Result for
Synonyms: IDB4 bHLHb27
UniProtKB ID: P47928, Q13005
Gene ID:
Human(3400) Summary: This gene encodes a member of the inhibitor of DNA binding (ID) protein family. These proteins are basic helix-loop-helix transcription factors which can act as tumor suppressors but lack DNA binding activity. Consequently, the activity of the encoded protein depends on the protein binding partner. [provided by RefSeq, Dec 2011]
Mouse(15904) inhibitor of DNA binding 4
Rat(291023) inhibitor of DNA binding 4
naked mole-rat(101699920) inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Zebrafish(664761) inhibitor of DNA binding 4
chicken(374150) inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
dog(610666) inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001546 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU157701 MISSION® esiRNA esiRNA targeting mouse Id4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001546 Rosetta Predictions human pricing
NM_175582 Rosetta Predictions rat pricing
NM_031166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113527 predicted 1047
2 SASI_Hs01_00113528 predicted 829
3 SASI_Hs01_00113529 predicted 966
4 SASI_Hs01_00113530 predicted 803
5 SASI_Hs01_00113531 predicted 878
6 SASI_Hs01_00113532 predicted 803
7 SASI_Hs01_00113533 predicted 959
8 SASI_Hs01_00113534 predicted 1039
9 SASI_Hs01_00113535 predicted 804
10 SASI_Hs01_00113536 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040657 predicted 176
2 SASI_Rn01_00040658 predicted 865
3 SASI_Rn01_00040659 predicted 619
4 SASI_Rn01_00040660 predicted 928
5 SASI_Rn01_00040661 predicted 822
6 SASI_Rn01_00040662 predicted 462
7 SASI_Rn01_00040663 predicted 768
8 SASI_Rn01_00040664 predicted 843
9 SASI_Rn01_00040665 predicted 270
10 SASI_Rn01_00040666 predicted 188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157330 predicted 958
2 SASI_Mm01_00157331 predicted 1003
3 SASI_Mm02_00336990 predicted 947
4 SASI_Mm02_00336991 predicted 958
5 SASI_Mm01_00157333 predicted 1003
6 SASI_Mm02_00336992 predicted 943
7 SASI_Mm01_00157334 predicted 996
8 SASI_Mm01_00157335 predicted 1012
9 SASI_Mm01_00157336 predicted 845
10 SASI_Mm01_00157337 predicted 900
11 SASI_Mm01_00157332 predicted 950
12 SASI_Mm01_00157338 predicted 792
13 SASI_Mm01_00157339 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001546
ID4 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001546.2-1195s1c1
Sequence:CCGGCCGACTTTAGAAGCCTACTTTCTCGAGAAAGTAGGCTTCTAAAGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-619s1c1
Sequence:CCGGCCCAACAAGAAAGTCAGCAAACTCGAGTTTGCTGACTTTCTTGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-627s1c1
Sequence:CCGGGAAAGTCAGCAAAGTGGAGATCTCGAGATCTCCACTTTGCTGACTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-566s1c1
Sequence:CCGGGCGATATGAACGACTGCTATACTCGAGTATAGCAGTCGTTCATATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-816s1c1
Sequence:CCGGCGCGGTGAACAAGCAGGGCGACTCGAGTCGCCCTGCTTGTTCACCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001546.2-554s21c1
Sequence:CCGGTGTGCCTGCAGTGCGATATGACTCGAGTCATATCGCACTGCAGGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1183s21c1
Sequence:CCGGTCAAGAGTAGATCCGACTTTACTCGAGTAAAGTCGGATCTACTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1036s21c1
Sequence:CCGGTCTTTCTTTGCACGTTCATAACTCGAGTTATGAACGTGCAAAGAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1257s21c1
Sequence:CCGGCTACCAGAGCATTGTAGATATCTCGAGATATCTACAATGCTCTGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001546
ID4 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001546.2-1195s1c1
Sequence:CCGGCCGACTTTAGAAGCCTACTTTCTCGAGAAAGTAGGCTTCTAAAGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-619s1c1
Sequence:CCGGCCCAACAAGAAAGTCAGCAAACTCGAGTTTGCTGACTTTCTTGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-627s1c1
Sequence:CCGGGAAAGTCAGCAAAGTGGAGATCTCGAGATCTCCACTTTGCTGACTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-566s1c1
Sequence:CCGGGCGATATGAACGACTGCTATACTCGAGTATAGCAGTCGTTCATATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-816s1c1
Sequence:CCGGCGCGGTGAACAAGCAGGGCGACTCGAGTCGCCCTGCTTGTTCACCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001546.2-554s21c1
Sequence:CCGGTGTGCCTGCAGTGCGATATGACTCGAGTCATATCGCACTGCAGGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1183s21c1
Sequence:CCGGTCAAGAGTAGATCCGACTTTACTCGAGTAAAGTCGGATCTACTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1036s21c1
Sequence:CCGGTCTTTCTTTGCACGTTCATAACTCGAGTTATGAACGTGCAAAGAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1257s21c1
Sequence:CCGGCTACCAGAGCATTGTAGATATCTCGAGATATCTACAATGCTCTGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001546
ID4 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001546.2-1195s1c1
Sequence:CCGGCCGACTTTAGAAGCCTACTTTCTCGAGAAAGTAGGCTTCTAAAGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-619s1c1
Sequence:CCGGCCCAACAAGAAAGTCAGCAAACTCGAGTTTGCTGACTTTCTTGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-627s1c1
Sequence:CCGGGAAAGTCAGCAAAGTGGAGATCTCGAGATCTCCACTTTGCTGACTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-566s1c1
Sequence:CCGGGCGATATGAACGACTGCTATACTCGAGTATAGCAGTCGTTCATATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001546.2-816s1c1
Sequence:CCGGCGCGGTGAACAAGCAGGGCGACTCGAGTCGCCCTGCTTGTTCACCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001546.2-554s21c1
Sequence:CCGGTGTGCCTGCAGTGCGATATGACTCGAGTCATATCGCACTGCAGGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1183s21c1
Sequence:CCGGTCAAGAGTAGATCCGACTTTACTCGAGTAAAGTCGGATCTACTCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1036s21c1
Sequence:CCGGTCTTTCTTTGCACGTTCATAACTCGAGTTATGAACGTGCAAAGAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001546.2-1257s21c1
Sequence:CCGGCTACCAGAGCATTGTAGATATCTCGAGATATCTACAATGCTCTGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031166
VALIDATED
ID4 MISSION shRNA Bacterial Glycerol Stock
inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-257s1c1
Sequence:CCGGGTGCCTGCAGTGCGATATGAACTCGAGTTCATATCGCACTGCAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-266s1c1
Sequence:CCGGGTGCGATATGAACGACTGCTACTCGAGTAGCAGTCGTTCATATCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-518s1c1
Sequence:CCGGCGCCGTGAACAAGCAGGGTGACTCGAGTCACCCTGCTTGTTCACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-356s1c1
Sequence:CCGGGCACGTTATCGACTACATCCTCTCGAGAGGATGTAGTCGATAACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031166.1-408s1c1
Sequence:CCGGGCTTTGCTGAGACAGCCGCCACTCGAGTGGCGGCTGTCTCAGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-621s21c1
Sequence:CCGGGAGGGCCAGAGCAGAAATTAACTCGAGTTAATTTCTGCTCTGGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-949s21c1
Sequence:CCGGCCAACCTTAGAGGCTACATTGCTCGAGCAATGTAGCCTCTAAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-802s21c1
Sequence:CCGGGTACGTATTCTCTTTCGTTTCCTCGAGGAAACGAAAGAGAATACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-929s21c1
Sequence:CCGGGTAGAAGAGCAATCGTGAATCCTCGAGGATTCACGATTGCTCTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-779s21c1
Sequence:CCGGTTGCACGTTCACGAGCATTCACTCGAGTGAATGCTCGTGAACGTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-674s21c1
Sequence:CCGGATCTTCAGCAAATCTAGAAACCTCGAGGTTTCTAGATTTGCTGAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-644s21c1
Sequence:CCGGGAAACAAGCCACCGGAGGAAACTCGAGTTTCCTCCGGTGGCTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-845s21c1
Sequence:CCGGTGTACGTTTCTGTGGTTATTTCTCGAGAAATAACCACAGAAACGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-886s21c1
Sequence:CCGGCAGTTAAACTTCGAAGCTTAACTCGAGTTAAGCTTCGAAGTTTAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031166
VALIDATED
ID4 MISSION shRNA shRNA Plasmid DNA
inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-257s1c1
Sequence:CCGGGTGCCTGCAGTGCGATATGAACTCGAGTTCATATCGCACTGCAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-266s1c1
Sequence:CCGGGTGCGATATGAACGACTGCTACTCGAGTAGCAGTCGTTCATATCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-518s1c1
Sequence:CCGGCGCCGTGAACAAGCAGGGTGACTCGAGTCACCCTGCTTGTTCACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-356s1c1
Sequence:CCGGGCACGTTATCGACTACATCCTCTCGAGAGGATGTAGTCGATAACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031166.1-408s1c1
Sequence:CCGGGCTTTGCTGAGACAGCCGCCACTCGAGTGGCGGCTGTCTCAGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-621s21c1
Sequence:CCGGGAGGGCCAGAGCAGAAATTAACTCGAGTTAATTTCTGCTCTGGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-949s21c1
Sequence:CCGGCCAACCTTAGAGGCTACATTGCTCGAGCAATGTAGCCTCTAAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-802s21c1
Sequence:CCGGGTACGTATTCTCTTTCGTTTCCTCGAGGAAACGAAAGAGAATACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-929s21c1
Sequence:CCGGGTAGAAGAGCAATCGTGAATCCTCGAGGATTCACGATTGCTCTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-779s21c1
Sequence:CCGGTTGCACGTTCACGAGCATTCACTCGAGTGAATGCTCGTGAACGTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-674s21c1
Sequence:CCGGATCTTCAGCAAATCTAGAAACCTCGAGGTTTCTAGATTTGCTGAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-644s21c1
Sequence:CCGGGAAACAAGCCACCGGAGGAAACTCGAGTTTCCTCCGGTGGCTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-845s21c1
Sequence:CCGGTGTACGTTTCTGTGGTTATTTCTCGAGAAATAACCACAGAAACGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-886s21c1
Sequence:CCGGCAGTTAAACTTCGAAGCTTAACTCGAGTTAAGCTTCGAAGTTTAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031166
VALIDATED
ID4 MISSION shRNA Lentiviral Transduction Particles
inhibitor of DNA binding 4, dominant negative helix-loop-helix protein
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-257s1c1
Sequence:CCGGGTGCCTGCAGTGCGATATGAACTCGAGTTCATATCGCACTGCAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-266s1c1
Sequence:CCGGGTGCGATATGAACGACTGCTACTCGAGTAGCAGTCGTTCATATCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-518s1c1
Sequence:CCGGCGCCGTGAACAAGCAGGGTGACTCGAGTCACCCTGCTTGTTCACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031166.1-356s1c1
Sequence:CCGGGCACGTTATCGACTACATCCTCTCGAGAGGATGTAGTCGATAACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031166.1-408s1c1
Sequence:CCGGGCTTTGCTGAGACAGCCGCCACTCGAGTGGCGGCTGTCTCAGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-621s21c1
Sequence:CCGGGAGGGCCAGAGCAGAAATTAACTCGAGTTAATTTCTGCTCTGGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-949s21c1
Sequence:CCGGCCAACCTTAGAGGCTACATTGCTCGAGCAATGTAGCCTCTAAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-802s21c1
Sequence:CCGGGTACGTATTCTCTTTCGTTTCCTCGAGGAAACGAAAGAGAATACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-929s21c1
Sequence:CCGGGTAGAAGAGCAATCGTGAATCCTCGAGGATTCACGATTGCTCTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-779s21c1
Sequence:CCGGTTGCACGTTCACGAGCATTCACTCGAGTGAATGCTCGTGAACGTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-674s21c1
Sequence:CCGGATCTTCAGCAAATCTAGAAACCTCGAGGTTTCTAGATTTGCTGAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-644s21c1
Sequence:CCGGGAAACAAGCCACCGGAGGAAACTCGAGTTTCCTCCGGTGGCTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-845s21c1
Sequence:CCGGTGTACGTTTCTGTGGTTATTTCTCGAGAAATAACCACAGAAACGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031166.2-886s21c1
Sequence:CCGGCAGTTAAACTTCGAAGCTTAACTCGAGTTAAGCTTCGAAGTTTAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)