EMAIL THIS PAGE TO A FRIEND

IDE

insulin-degrading enzyme

66 Gene Product Result for
Synonyms: INSULYSIN
UniProtKB ID: P14735, B2R721, B7ZAU2, D3DR35, Q5T5N2
Gene ID:
Human(3416) Summary: This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]
Mouse(15925) insulin degrading enzyme
Rat(25700) insulin degrading enzyme
Zebrafish(561390) insulin-degrading enzyme
domestic cat(101093646) insulin-degrading enzyme
cow(523752) insulin-degrading enzyme
Horse(100071303) insulin-degrading enzyme
dog(477768) insulin-degrading enzyme
chicken(423814) insulin-degrading enzyme
fruit fly(40248) Insulin degrading metalloproteinase
domestic guinea pig(100719651) insulin-degrading enzyme
naked mole-rat(101706921) insulin-degrading enzyme
sheep(101104194) insulin-degrading enzyme
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004969 Rosetta Predictions human pricing
NM_013159 Rosetta Predictions rat pricing
NM_031156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338670 predicted 2506
2 SASI_Hs01_00202496 predicted 2768
3 SASI_Hs02_00338671 predicted 2598
4 SASI_Hs01_00202497 predicted 2727
5 SASI_Hs01_00202499 predicted 2155
6 SASI_Hs01_00202500 predicted 1312
7 SASI_Hs01_00202502 predicted 2737
8 SASI_Hs01_00202503 predicted 327
9 SASI_Hs02_00338672 predicted 3140
10 SASI_Hs01_00202504 predicted 2292
11 SASI_Hs01_00202498 predicted 2300
12 SASI_Hs01_00202501 predicted 2585
13 SASI_Hs01_00202505 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260973 predicted 813
2 SASI_Rn01_00080651 predicted 1816
3 SASI_Rn01_00080653 predicted 445
4 SASI_Rn01_00080654 predicted 2228
5 SASI_Rn01_00080656 predicted 1384
6 SASI_Rn02_00260974 predicted 1647
7 SASI_Rn01_00080657 predicted 750
8 SASI_Rn01_00080658 predicted 2863
9 SASI_Rn01_00080659 predicted 1148
10 SASI_Rn01_00080660 predicted 2773
11 SASI_Rn01_00080652 predicted 2013
12 SASI_Rn01_00080655 predicted 1887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178259 predicted 2627
2 SASI_Mm01_00178260 predicted 2253
3 SASI_Mm01_00178262 predicted 474
4 SASI_Mm01_00178263 predicted 2690
5 SASI_Mm01_00178264 predicted 2729
6 SASI_Mm01_00178265 predicted 1473
7 SASI_Mm01_00178266 predicted 2122
8 SASI_Mm01_00178267 predicted 1413
9 SASI_Mm02_00336966 predicted 1675
10 SASI_Mm02_00336967 predicted 780
11 SASI_Mm01_00178261 predicted 2036
12 SASI_Mm01_00178268 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004969
VALIDATED
IDE MISSION shRNA Bacterial Glycerol Stock
insulin-degrading enzyme
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004969.2-502s21c1
Sequence:CCGGTAGTGGAGAGCATACCAATTACTCGAGTAATTGGTATGCTCTCCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-816s21c1
Sequence:CCGGCTTACTATTCATCCAACTTAACTCGAGTTAAGTTGGATGAATAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-229s1c1
Sequence:CCGGCCTGAAGACAAGCGAGAATATCTCGAGATATTCTCGCTTGTCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-1045s1c1
Sequence:CCGGCCTGGTCATTATCTTGGTCATCTCGAGATGACCAAGATAATGACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-1438s1c1
Sequence:CCGGCCTGACTTAATAGAGATGGTTCTCGAGAACCATCTCTATTAAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004969.x-3131s1c1
Sequence:CCGGATGGGAAAGTGCAAGTGGATGCTCGAGCATCCACTTGCACTTTCCCATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-1210s21c1
Sequence:CCGGCTTGACCGAGGAAGGATTATTCTCGAGAATAATCCTTCCTCGGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-2436s21c1
Sequence:CCGGATAACTGTGGCATCGAGATATCTCGAGATATCTCGATGCCACAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-3219s21c1
Sequence:CCGGTAGTTTCTGATTCACTATTAGCTCGAGCTAATAGTGAATCAGAAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004969
VALIDATED
IDE MISSION shRNA shRNA Plasmid DNA
insulin-degrading enzyme
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004969.2-502s21c1
Sequence:CCGGTAGTGGAGAGCATACCAATTACTCGAGTAATTGGTATGCTCTCCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-816s21c1
Sequence:CCGGCTTACTATTCATCCAACTTAACTCGAGTTAAGTTGGATGAATAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-229s1c1
Sequence:CCGGCCTGAAGACAAGCGAGAATATCTCGAGATATTCTCGCTTGTCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-1045s1c1
Sequence:CCGGCCTGGTCATTATCTTGGTCATCTCGAGATGACCAAGATAATGACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-1438s1c1
Sequence:CCGGCCTGACTTAATAGAGATGGTTCTCGAGAACCATCTCTATTAAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004969.x-3131s1c1
Sequence:CCGGATGGGAAAGTGCAAGTGGATGCTCGAGCATCCACTTGCACTTTCCCATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-1210s21c1
Sequence:CCGGCTTGACCGAGGAAGGATTATTCTCGAGAATAATCCTTCCTCGGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-2436s21c1
Sequence:CCGGATAACTGTGGCATCGAGATATCTCGAGATATCTCGATGCCACAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-3219s21c1
Sequence:CCGGTAGTTTCTGATTCACTATTAGCTCGAGCTAATAGTGAATCAGAAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004969
VALIDATED
IDE MISSION shRNA Lentiviral Transduction Particles
insulin-degrading enzyme
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004969.2-502s21c1
Sequence:CCGGTAGTGGAGAGCATACCAATTACTCGAGTAATTGGTATGCTCTCCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-816s21c1
Sequence:CCGGCTTACTATTCATCCAACTTAACTCGAGTTAAGTTGGATGAATAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-229s1c1
Sequence:CCGGCCTGAAGACAAGCGAGAATATCTCGAGATATTCTCGCTTGTCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-1045s1c1
Sequence:CCGGCCTGGTCATTATCTTGGTCATCTCGAGATGACCAAGATAATGACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004969.x-1438s1c1
Sequence:CCGGCCTGACTTAATAGAGATGGTTCTCGAGAACCATCTCTATTAAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004969.x-3131s1c1
Sequence:CCGGATGGGAAAGTGCAAGTGGATGCTCGAGCATCCACTTGCACTTTCCCATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-1210s21c1
Sequence:CCGGCTTGACCGAGGAAGGATTATTCTCGAGAATAATCCTTCCTCGGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-2436s21c1
Sequence:CCGGATAACTGTGGCATCGAGATATCTCGAGATATCTCGATGCCACAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004969.2-3219s21c1
Sequence:CCGGTAGTTTCTGATTCACTATTAGCTCGAGCTAATAGTGAATCAGAAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031156
VALIDATED
IDE MISSION shRNA Bacterial Glycerol Stock
insulin-degrading enzyme
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031156.1-3174s1c1
Sequence:CCGGGCTTGCTATTAGAGAGACAAACTCGAGTTTGTCTCTCTAATAGCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031156.1-1358s1c1
Sequence:CCGGGCAGGAAAGTTGCACTATTATCTCGAGATAATAGTGCAACTTTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031156.1-3063s1c1
Sequence:CCGGCCCTCGTGAAACCACATATTACTCGAGTAATATGTGGTTTCACGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031156.1-2210s1c1
Sequence:CCGGCGGCTGCATATTGAAGCACTTCTCGAGAAGTGCTTCAATATGCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031156.1-1475s1c1
Sequence:CCGGCGGGTGGCAATAGTTTCCAAACTCGAGTTTGGAAACTATTGCCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031156
VALIDATED
IDE MISSION shRNA shRNA Plasmid DNA
insulin-degrading enzyme
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031156.1-3174s1c1
Sequence:CCGGGCTTGCTATTAGAGAGACAAACTCGAGTTTGTCTCTCTAATAGCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031156.1-1358s1c1
Sequence:CCGGGCAGGAAAGTTGCACTATTATCTCGAGATAATAGTGCAACTTTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031156.1-3063s1c1
Sequence:CCGGCCCTCGTGAAACCACATATTACTCGAGTAATATGTGGTTTCACGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031156.1-2210s1c1
Sequence:CCGGCGGCTGCATATTGAAGCACTTCTCGAGAAGTGCTTCAATATGCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031156.1-1475s1c1
Sequence:CCGGCGGGTGGCAATAGTTTCCAAACTCGAGTTTGGAAACTATTGCCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031156
VALIDATED
IDE MISSION shRNA Lentiviral Transduction Particles
insulin-degrading enzyme
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031156.1-3174s1c1
Sequence:CCGGGCTTGCTATTAGAGAGACAAACTCGAGTTTGTCTCTCTAATAGCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031156.1-1358s1c1
Sequence:CCGGGCAGGAAAGTTGCACTATTATCTCGAGATAATAGTGCAACTTTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031156.1-3063s1c1
Sequence:CCGGCCCTCGTGAAACCACATATTACTCGAGTAATATGTGGTTTCACGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031156.1-2210s1c1
Sequence:CCGGCGGCTGCATATTGAAGCACTTCTCGAGAAGTGCTTCAATATGCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031156.1-1475s1c1
Sequence:CCGGCGGGTGGCAATAGTTTCCAAACTCGAGTTTGGAAACTATTGCCACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)